Region for Gene F14B4.2a

This page describes one promoter-based search region.

The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.

The first track shows the location of the search region in red. The last track shows known gene locations in this 100000 bp span of the genome.

This promoter-based search region is located close to a particular gene of interest, described in the table below. Click on the gene id to open a page at ensembl.org with more information about this gene.

The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit. Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not any modules of that type exist, and if so, whether or not all the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)

User-specified filter settings do not affect the features displayed in the UCSC genome browser view.

About the patterns shown in this image:
There are no 'de novo' patterns to show.
There are no (TRANSFAC) annotation-based patterns to show.
There are no (JASPAR) annotation-based patterns to show.

Click on the image to view this region at UCSC.

This image uses the C.elegans genome assembly from Jan 2007. (UCSC ce4, WS170, Ensembl v45) and contains a number of custom tracks followed by several UCSC tracks. The custom tracks show: The long red and gray bar at the top shows the nominal 'search region' within which comparative genomics discovery methods were applied. Motif predictions were not made in coding exons and most types of repeats. In this database, the locations of masks applied to the search region are shown in gray. The numbered brown blocks are 'atomic' motifs, i.e. conserved DNA sequence motifs that were identified by discovery methods and post-processing operations. Motifs are shaded to indicate the discovery p-value; a darker motif was more significant at the discovery stage. Following the motif discovery stage, motifs were filtered by membership in co-occurring patterns, and patterns were ranked by genome-scale properties. Motifs instances that occur in highly-ranked putative regulatory modules may be more reliable predictions of functional genomic elements. The connected sets of blue boxes are co-occurring patterns, i.e. putative regulatory modules. Modules are shaded to indicate the number of times that a pattern is found in the target genome; a darker module is associated with more search regions. An pattern is called either 'de novo' or annotation-based, depending on the type of groups that appear in the pattern. (see next point) Before patterns (i.e. modules) can be identified from atomic motifs, groups of similar motifs must be found; modules are then identified as co-occurring 'group labels' that satisfy certain criteria. Such groups can be identified a) by annotating atomic motifs with known binding site resources from TRANSFAC, JASPAR or ORegAnno; or b) by 'de novo' clustering. Currently we show both types of patterns, but we consider annotation-based groups and patterns to be more reliable than 'de novo' groups and patterns. Work to improve genome-scale 'de novo' grouping is ongoing.

Showing 50 out of 50 atomic motifs.

Group(s) crtCele#(name) [p-value]	Motif craCele#	Discovery p-value	Location	Width	(+)motif	(-)motif
0 annotated groups 0 'de novo' group(s)	49487	4.74E-01	CHROMOSOME_I:9,273,840-9,273,847	8	TCGTTwCT	AGsAACGA
0 annotated groups 0 'de novo' group(s)	49486	1.40E-01	CHROMOSOME_I:9,273,846-9,273,853	8	TTCTTATC	GATAAGAA
1 annotated group(s): 50007 (Androgen) [3.27E-05] 0 'de novo' group(s)	49485	8.20E-02	CHROMOSOME_I:9,273,909-9,273,916	8	TGTTCTTw	sAAGAACA
1 annotated group(s): 50007 (Androgen) [3.27E-05] 0 'de novo' group(s)	49484	5.88E-01	CHROMOSOME_I:9,273,916-9,273,929	14	AAArATAACAwnAn	nTnsTGTTATyTTT
0 annotated groups 0 'de novo' group(s)	49483	3.62E-01	CHROMOSOME_I:9,273,975-9,273,982	8	GAwGACGT	ACGTCsTC
0 annotated groups 0 'de novo' group(s)	49482	7.60E-01	CHROMOSOME_I:9,274,009-9,274,022	14	TACnGTAACTTkTn	nAmAAGTTACnGTA
0 annotated groups 0 'de novo' group(s)	49481	7.02E-01	CHROMOSOME_I:9,274,022-9,274,035	14	GCCGCyTTCkTTTT	AAAAmGAArGCGGC
0 annotated groups 6 'de novo' group(s) 6, 79, 165, 184, 574, 668	49480	6.38E-01	CHROMOSOME_I:9,274,028-9,274,048	21	nAnrrnTACGGTAGCnG...	nAACCnGCTACCGTAny...
0 annotated groups 2 'de novo' group(s) 793, 2199	49479	5.78E-01	CHROMOSOME_I:9,274,047-9,274,060	14	ATCACGTCATCATA	TATGATGACGTGAT
0 annotated groups 0 'de novo' group(s)	49478	4.60E-01	CHROMOSOME_I:9,274,103-9,274,113	11	TAGATAAGAAn	nTTCTTATCTA
0 annotated groups 0 'de novo' group(s)	49477	4.92E-02	CHROMOSOME_I:9,274,164-9,274,171	8	ATTCTTAT	ATAAGAAT
0 annotated groups 0 'de novo' group(s)	49476	7.78E-02	CHROMOSOME_I:9,274,189-9,274,196	8	AAGGCGCA	TGCGCCTT
0 annotated groups 0 'de novo' group(s)	49475	1.00E-08	CHROMOSOME_I:9,274,197-9,274,202	6	CTTCGC	GCGAAG
0 annotated groups 4 'de novo' group(s) 24, 98, 884, 2048	49474	3.79E-01	CHROMOSOME_I:9,274,223-9,274,239	17	GAnGAGGmGGAGAAAAn	nTTTTCTCCkCCTCnTC
0 annotated groups 0 'de novo' group(s)	49473	5.34E-01	CHROMOSOME_I:9,274,242-9,274,252	11	wrAGAACAAAs	wTTTGTTCTys
0 annotated groups 2 'de novo' group(s) 94, 1491	49472	9.30E-01	CHROMOSOME_I:9,274,249-9,274,267	19	AmnnTnACTGTAnnnTGnn	nnCAnnnTACAGTnAnnkT
0 annotated groups 0 'de novo' group(s)	49471	2.48E-01	CHROMOSOME_I:9,274,264-9,274,273	10	yTnATCACGT	ACGTGATnAr
0 annotated groups 0 'de novo' group(s)	49470	1.00E-08	CHROMOSOME_I:9,274,271-9,274,278	8	CTGATTTA	TAAATCAG
0 annotated groups 2 'de novo' group(s) 34, 2089	49469	2.03E-01	CHROMOSOME_I:9,274,294-9,274,307	14	AACATkTGCAAATA	TATTTGCAmATGTT
0 annotated groups 0 'de novo' group(s)	49468	7.95E-01	CHROMOSOME_I:9,274,316-9,274,325	10	AAGAAmACGA	TCGTkTTCTT
0 annotated groups 0 'de novo' group(s)	49467	2.48E-01	CHROMOSOME_I:9,274,352-9,274,361	10	CTGATGATCT	AGATCATCAG
0 annotated groups 1 'de novo' group(s) 1828	49466	4.99E-01	CHROMOSOME_I:9,274,357-9,274,373	17	TkyTCTyTGCTACTGwT	AsCAGTAGCArAGArmA
0 annotated groups 2 'de novo' group(s) 20, 203	49465	9.42E-01	CHROMOSOME_I:9,274,376-9,274,389	14	wCrGTArCyGGyTn	nArCCrGyTACyGs
1 annotated group(s): 50062 (NRF-2) [9.42E-05] 1 'de novo' group(s) 53	49464	9.60E-01	CHROMOSOME_I:9,274,387-9,274,400	14	nTCmCGTCAyCwTA	TAsGrTGACGkGAn
1 annotated group(s): 50062 (NRF-2) [9.42E-05] 0 'de novo' group(s)	49463	2.54E-01	CHROMOSOME_I:9,274,398-9,274,411	14	TTCTCCTCCTCnTC	GAnGAGGAGGAGAA
0 annotated groups 0 'de novo' group(s)	49462	5.20E-01	CHROMOSOME_I:9,274,409-9,274,423	15	nnnTTCTCCTCCTTC	GAAGGAGGAGAAnnn
1 annotated group(s): 50091 (Tal1beta-E47S) [5.36E-05] 3 'de novo' group(s) 41, 92, 113	49461	6.48E-01	CHROMOSOME_I:9,274,436-9,274,449	14	mAGryGGCGAsCCC	GGGwTCGCCryCTk
0 annotated groups 0 'de novo' group(s)	49460	1.40E-01	CHROMOSOME_I:9,274,449-9,274,456	8	TTCTTATC	GATAAGAA
0 annotated groups 0 'de novo' group(s)	49459	7.22E-01	CHROMOSOME_I:9,274,453-9,274,464	12	kTTCTnCGCTGT	ACAGCGnAGAAm
0 annotated groups 0 'de novo' group(s)	49458	8.48E-01	CHROMOSOME_I:9,274,458-9,274,473	16	nCGyCTTCnTwTCTnT	AnAGAsAnGAAGrCGn
1 annotated group(s): 40113 (LEF-1) [5.31E-06] 5 'de novo' group(s) 24, 47, 226, 859, 2949	49457	8.67E-01	CHROMOSOME_I:9,274,470-9,274,496	27	AwAAAArGnCkCGCCGC...	AAnAACGAAGGCGGCGm...
0 annotated groups 0 'de novo' group(s)	49456	1.40E-01	CHROMOSOME_I:9,274,495-9,274,502	8	TGTTCTTA	TAAGAACA
0 annotated groups 2 'de novo' group(s) 26, 353	49455	8.28E-01	CHROMOSOME_I:9,274,505-9,274,518	14	GArAmnGnTACTGw	sCAGTAnCnkTyTC
0 annotated groups 0 'de novo' group(s)	49454	1.08E-01	CHROMOSOME_I:9,274,560-9,274,574	15	rTAAATCAGACCACC	GGTGGTCTGATTTAy
0 annotated groups 0 'de novo' group(s)	49453	7.08E-01	CHROMOSOME_I:9,274,677-9,274,686	10	GCTACyGnAC	GTnCrGTAGC
0 annotated groups 0 'de novo' group(s)	49452	1.40E-01	CHROMOSOME_I:9,274,686-9,274,693	8	TGATGACG	CGTCATCA
0 annotated groups 0 'de novo' group(s)	49451	1.40E-01	CHROMOSOME_I:9,274,694-9,274,701	8	GTCTGATT	AATCAGAC
0 annotated groups 3 'de novo' group(s) 5, 65, 84	49450	4.61E-01	CHROMOSOME_I:9,274,709-9,274,722	14	GGCTCCGCCCmCTT	AAGkGGGCGGAGCC
2 annotated group(s): 50058 (Max) [2.07E-05] 50059 (Myc-Max) [2.30E-05] 5 'de novo' group(s) 2, 86, 1348, 1512, 3012	49449	7.67E-01	CHROMOSOME_I:9,274,728-9,274,756	29	ynnCGTnnsnTGwTGAT...	AAGAATCGAGAGATCAs...
0 annotated groups 0 'de novo' group(s)	49448	2.56E-01	CHROMOSOME_I:9,274,753-9,274,760	8	CTCTTTTA	TAAAAGAG
1 annotated group(s): 50072 (RORalfa-2) [7.10E-05] 0 'de novo' group(s)	49447	1.62E-01	CHROMOSOME_I:9,274,793-9,274,807	15	TAATTTTGATCTACn	nGTAGATCAAAATTA
0 annotated groups 0 'de novo' group(s)	49446	3.16E-01	CHROMOSOME_I:9,274,820-9,274,829	10	ACGTCATCAT	ATGATGACGT
0 annotated groups 0 'de novo' group(s)	49445	4.03E-01	CHROMOSOME_I:9,274,832-9,274,846	15	nAnAAGTCACGTTTT	AAAACGTGACTTnTn
0 annotated groups 0 'de novo' group(s)	49444	9.96E-02	CHROMOSOME_I:9,274,902-9,274,911	10	CATTTGCAAA	TTTGCAAATG
0 annotated groups 1 'de novo' group(s) 57	49443	7.93E-01	CHROMOSOME_I:9,274,987-9,274,998	12	CACGTGGCGrrr	yyyCGCCACGTG
0 annotated groups 3 'de novo' group(s) 6, 79, 1469	49442	5.91E-01	CHROMOSOME_I:9,275,007-9,275,021	15	AAnsnGCTACCGTAn	nTACGGTAGCnwnTT
0 annotated groups 0 'de novo' group(s)	49441	6.60E-01	CHROMOSOME_I:9,275,048-9,275,062	15	ArnAACGAAGrCGkC	GmCGyCTTCGTTnyT
0 annotated groups 3 'de novo' group(s) 6, 675, 3016	49440	9.42E-01	CHROMOSOME_I:9,275,156-9,275,175	20	GTTCTTATCACGTCATCATA	TATGATGACGTGATAAGAAC
0 annotated groups 0 'de novo' group(s)	49439	1.00E-08	CHROMOSOME_I:9,275,211-9,275,218	8	GTCTGATT	AATCAGAC
0 annotated groups 0 'de novo' group(s)	49438	7.64E-01	CHROMOSOME_I:9,275,222-9,275,235	14	TACAGTnnCnTTTT	AAAAnGnnACTGTA