Region for Gene F45H7.4

This page describes one promoter-based search region.

The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.

The first track shows the location of the search region in red. The last track shows known gene locations in this 100000 bp span of the genome.

This promoter-based search region is located close to a particular gene of interest, described in the table below. Click on the gene id to open a page at ensembl.org with more information about this gene.

The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit. Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not any modules of that type exist, and if so, whether or not all the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)

User-specified filter settings do not affect the features displayed in the UCSC genome browser view.

About the patterns shown in this image:
There are no 'de novo' patterns to show.
There are no (TRANSFAC) annotation-based patterns to show.
There are no (JASPAR) annotation-based patterns to show.

Click on the image to view this region at UCSC.

This image uses the C.elegans genome assembly from Jan 2007. (UCSC ce4, WS170, Ensembl v45) and contains a number of custom tracks followed by several UCSC tracks. The custom tracks show: The long red and gray bar at the top shows the nominal 'search region' within which comparative genomics discovery methods were applied. Motif predictions were not made in coding exons and most types of repeats. In this database, the locations of masks applied to the search region are shown in gray. The numbered brown blocks are 'atomic' motifs, i.e. conserved DNA sequence motifs that were identified by discovery methods and post-processing operations. Motifs are shaded to indicate the discovery p-value; a darker motif was more significant at the discovery stage. Following the motif discovery stage, motifs were filtered by membership in co-occurring patterns, and patterns were ranked by genome-scale properties. Motifs instances that occur in highly-ranked putative regulatory modules may be more reliable predictions of functional genomic elements. The connected sets of blue boxes are co-occurring patterns, i.e. putative regulatory modules. Modules are shaded to indicate the number of times that a pattern is found in the target genome; a darker module is associated with more search regions. An pattern is called either 'de novo' or annotation-based, depending on the type of groups that appear in the pattern. (see next point) Before patterns (i.e. modules) can be identified from atomic motifs, groups of similar motifs must be found; modules are then identified as co-occurring 'group labels' that satisfy certain criteria. Such groups can be identified a) by annotating atomic motifs with known binding site resources from TRANSFAC, JASPAR or ORegAnno; or b) by 'de novo' clustering. Currently we show both types of patterns, but we consider annotation-based groups and patterns to be more reliable than 'de novo' groups and patterns. Work to improve genome-scale 'de novo' grouping is ongoing.

Showing 59 out of 59 atomic motifs.

Group(s) crtCele#(name) [p-value]	Motif craCele#	Discovery p-value	Location	Width	(+)motif	(-)motif
1 annotated group(s): 50092 (Thing1-E47) [7.20E-05] 0 'de novo' group(s)	70248	4.84E-02	CHROMOSOME_III:3,366,709-3,366,734	26	CACCAATGACACTTCCA...	CGCAAGAACTGGAAGTG...
0 annotated groups 0 'de novo' group(s)	70247	3.98E-01	CHROMOSOME_III:3,366,743-3,366,769	27	CGTCTCCCGGTGCATCC...	TTTkGGTnCCGGATGCA...
0 annotated groups 1 'de novo' group(s) 1205	70246	4.85E-02	CHROMOSOME_III:3,366,773-3,366,799	27	AGTTCAAAATTACGCGA...	GTGTnGGTTGTCGCGTA...
0 annotated groups 0 'de novo' group(s)	70245	4.70E-01	CHROMOSOME_III:3,366,793-3,366,806	14	CArTTnTAGTTCrA	TyGAACTAnAAyTG
0 annotated groups 1 'de novo' group(s) 48	70244	7.72E-01	CHROMOSOME_III:3,366,818-3,366,831	14	mrAAAyTACCmGTT	AACkGGTArTTTyk
0 annotated groups 1 'de novo' group(s) 1	70243	1.00E-08	CHROMOSOME_III:3,366,868-3,366,886	19	CTTATCTTTATTGTTTTCC	GGAAAACAATAAAGATAAG
2 annotated group(s): 50025 (E4BP4) [4.30E-06] 50043 (HLF) [5.24E-05] 3 'de novo' group(s) 19, 140, 1187	70242	3.68E-01	CHROMOSOME_III:3,366,897-3,366,917	21	TynTCyTACGTAATTTC...	AACGGAAATTACGTArG...
0 annotated groups 0 'de novo' group(s)	70241	8.00E-02	CHROMOSOME_III:3,366,919-3,366,936	18	yAGACAATTATAGTTTGC	GCAAACTATAATTGTCTr
1 annotated group(s): 40140 (Nkx2-5) [5.81E-06] 0 'de novo' group(s)	70240	9.10E-01	CHROMOSOME_III:3,366,942-3,366,955	14	AGTTCAAAAnwAmG	CkTsnTTTTGAACT
1 annotated group(s): 40140 (Nkx2-5) [5.81E-06] 0 'de novo' group(s)	70239	5.91E-01	CHROMOSOME_III:3,366,949-3,366,960	12	CTTCCAGTkCTT	AAGmACTGGAAG
0 annotated groups 0 'de novo' group(s)	70238	7.57E-01	CHROMOSOME_III:3,366,961-3,366,970	10	GAnCAnTGAC	GTCAnTGnTC
0 annotated groups 0 'de novo' group(s)	70237	7.72E-01	CHROMOSOME_III:3,366,977-3,366,990	14	CCATnCTGTAGGGA	TCCCTACAGnATGG
2 annotated group(s): 50058 (Max) [3.28E-06] 50059 (Myc-Max) [1.49E-05] 4 'de novo' group(s) 2, 64, 86, 2063	70236	7.82E-01	CHROMOSOME_III:3,367,019-3,367,036	18	GTATGGCACGTGnTwCnn	nnGsAnCACGTGCCATAC
0 annotated groups 0 'de novo' group(s)	70235	8.01E-01	CHROMOSOME_III:3,367,062-3,367,073	12	CCATACTGTAGG	CCTACAGTATGG
0 annotated groups 1 'de novo' group(s) 774	70234	6.73E-01	CHROMOSOME_III:3,367,091-3,367,104	14	AGAmAAnTATAGwT	AsCTATAnTTkTCT
1 annotated group(s): 30009 (DAF-19) [3.14E-05] 0 'de novo' group(s)	70233	5.20E-01	CHROMOSOME_III:3,367,114-3,367,128	15	AwmACCATGACAACA	TGTTGTCATGGTksT
1 annotated group(s): 30009 (DAF-19) [3.14E-05] 0 'de novo' group(s)	70232	4.26E-01	CHROMOSOME_III:3,367,122-3,367,136	15	CATAATAAATAnnnA	TnnnTATTTATTATG
0 annotated groups 1 'de novo' group(s) 21	70231	6.74E-01	CHROMOSOME_III:3,367,178-3,367,193	16	nnwCnnTAGACGTCnn	nnGACGTCTAnnGsnn
0 annotated groups 0 'de novo' group(s)	70230	4.74E-01	CHROMOSOME_III:3,367,204-3,367,215	12	ATCTTTATTGTT	AACAATAAAGAT
2 annotated group(s): 50017 (COUP-TF) [3.22E-05] 50065 (PPARgamma-RXRal) [5.89E-05] 0 'de novo' group(s)	70229	2.81E-01	CHROMOSOME_III:3,367,226-3,367,241	16	CGCGTAATTTTGAACT	AGTTCAAAATTACGCG
0 annotated groups 0 'de novo' group(s)	70228	2.81E-01	CHROMOSOME_III:3,367,257-3,367,272	16	AGCATCATAATAAATA	TATTTATTATGATGCT
0 annotated groups 1 'de novo' group(s) 518	70227	2.74E-01	CHROMOSOME_III:3,367,271-3,367,281	11	AGCATCATAAT	ATTATGATGCT
1 annotated group(s): 50014 (Bsap) [5.00E-05] 1 'de novo' group(s) 21	70226	4.99E-01	CHROMOSOME_III:3,367,304-3,367,323	20	TCTTCAGACGTCAGAATAnT	AnTATTCTGACGTCTGAAGA
0 annotated groups 0 'de novo' group(s)	70225	1.98E-01	CHROMOSOME_III:3,367,334-3,367,340	7	GTCGCGT	ACGCGAC
0 annotated groups 0 'de novo' group(s)	70224	4.74E-01	CHROMOSOME_III:3,367,365-3,367,376	12	ACrTAATTTCyG	CrGAAATTAyGT
0 annotated groups 1 'de novo' group(s) 1371	70223	6.73E-01	CHROMOSOME_III:3,367,383-3,367,396	14	yAGACAATTATAGT	ACTATAATTGTCTr
0 annotated groups 0 'de novo' group(s)	70222	6.10E-01	CHROMOSOME_III:3,367,389-3,367,405	17	CTArmATCATArwAAAy	rTTTsyTATGATkyTAG
0 annotated groups 0 'de novo' group(s)	70221	8.26E-01	CHROMOSOME_III:3,367,408-3,367,419	12	CnGATTCAnnGA	TCnnTGAATCnG
1 annotated group(s): 50018 (CREB) [3.06E-05] 2 'de novo' group(s) 21, 240	70220	4.07E-01	CHROMOSOME_III:3,367,435-3,367,445	11	AGACGTCGAkw	smTCGACGTCT
0 annotated groups 0 'de novo' group(s)	70219	2.85E-01	CHROMOSOME_III:3,367,488-3,367,495	8	yGnCGCGT	ACGCGnCr
1 annotated group(s): 40003 (AhR) [1.52E-06] 1 'de novo' group(s) 325	70218	4.74E-01	CHROMOSOME_III:3,367,509-3,367,516	8	CGCGACAA	TTGTCGCG
0 annotated groups 1 'de novo' group(s) 48	70217	8.80E-01	CHROMOSOME_III:3,367,530-3,367,541	12	CGGTGCATCCGG	CCGGATGCACCG
1 annotated group(s): 50073 (RREB-1) [9.86E-06] 0 'de novo' group(s)	70216	8.56E-01	CHROMOSOME_III:3,367,540-3,367,549	10	GGTGCATCCG	CGGATGCACC
1 annotated group(s): 50073 (RREB-1) [9.86E-06] 0 'de novo' group(s)	70215	3.72E-01	CHROMOSOME_III:3,367,546-3,367,559	14	TATTTATTATGATG	CATCATAATAAATA
0 annotated groups 2 'de novo' group(s) 32, 202	70214	3.98E-01	CHROMOSOME_III:3,367,586-3,367,594	9	GTCGCGTAA	TTACGCGAC
1 annotated group(s): 50073 (RREB-1) [1.52E-05] 0 'de novo' group(s)	70213	8.56E-01	CHROMOSOME_III:3,367,598-3,367,612	15	nCCGGATGCACCGGG	CCCGGTGCATCCGGn
0 annotated groups 1 'de novo' group(s) 56	70212	7.72E-01	CHROMOSOME_III:3,367,644-3,367,657	14	ACCnAyrCnTTCGT	ACGAAnGyrTnGGT
0 annotated groups 2 'de novo' group(s) 56, 256	70211	6.73E-01	CHROMOSOME_III:3,367,650-3,367,663	14	AGCACGTGCCATnC	GnATGGCACGTGCT
1 annotated group(s): 50076 (SAP-1) [3.88E-05] 2 'de novo' group(s) 174, 2054	70210	9.38E-01	CHROMOSOME_III:3,367,721-3,367,747	27	nTTnTTTTCnrnTTkTC...	TAGGGAACAAGAmAAny...
0 annotated groups 0 'de novo' group(s)	70209	9.26E-01	CHROMOSOME_III:3,367,805-3,367,821	17	rTnnnnAnGCAAACTAT	ATAGTTTGCnTnnnnAy
0 annotated groups 1 'de novo' group(s) 50	70208	1.92E-01	CHROMOSOME_III:3,367,823-3,367,837	15	AGAAGTTTGGCGATC	GATCGCCAAACTTCT
1 annotated group(s): 50051 (Irf-2) [7.69E-05] 3 'de novo' group(s) 760, 1073, 2077	70206	9.17E-02	CHROMOSOME_III:3,367,836-3,367,876	41	CTTnTTGTACCCGAAAA...	nnnnGnnwGTACATTTG...
0 annotated groups 1 'de novo' group(s) 336	70205	2.07E-01	CHROMOSOME_III:3,367,888-3,367,907	20	GACGATAACAATCGACGTCT	AGACGTCGATTGTTATCGTC
0 annotated groups 0 'de novo' group(s)	70204	2.06E-01	CHROMOSOME_III:3,367,909-3,367,918	10	CCAATGACAC	GTGTCATTGG
2 annotated group(s): 50074 (RXR-VDR) [2.30E-06] 40167 (PPAR-alpha) [9.02E-06] 0 'de novo' group(s)	70203	4.39E-01	CHROMOSOME_III:3,367,919-3,367,935	17	AnGGGTTCACTGAATTG	CAATTCAGTGAACCCnT
4 annotated group(s): 50074 (RXR-VDR) [2.30E-06] 40167 (PPAR-alpha) [9.02E-06] 50058 (Max) [2.07E-05] ... 4 'de novo' group(s) 2, 216, 972, 1065	70202	5.55E-01	CHROMOSOME_III:3,367,932-3,367,963	32	TGTTCCCTACAGTATGG...	nnnnsGsAGCACGTGCC...
0 annotated groups 1 'de novo' group(s) 62	70201	7.85E-01	CHROMOSOME_III:3,367,983-3,367,997	15	CGmAmGAACTGGwnn	nnsCCAGTTCkTkCG
0 annotated groups 0 'de novo' group(s)	70200	7.51E-01	CHROMOSOME_III:3,367,994-3,368,003	10	CAnCAmyGAC	GTCrkTGnTG
0 annotated groups 0 'de novo' group(s)	70199	3.16E-01	CHROMOSOME_III:3,368,023-3,368,032	10	CTATAATTGT	ACAATTATAG
0 annotated groups 1 'de novo' group(s) 42	70198	6.73E-01	CHROMOSOME_III:3,368,041-3,368,054	14	GACTCnTCCCGwTT	AAsCGGGAnGAGTC
0 annotated groups 2 'de novo' group(s) 37, 2235	70197	8.56E-01	CHROMOSOME_III:3,368,067-3,368,086	20	TwyArnnnnmCATGACAwCA	TGsTGTCATGknnnnyTrsA
0 annotated groups 0 'de novo' group(s)	70196	7.72E-01	CHROMOSOME_III:3,368,079-3,368,092	14	CAArACTAynAGTT	AACTnrTAGTyTTG
0 annotated groups 0 'de novo' group(s)	70195	7.12E-01	CHROMOSOME_III:3,368,091-3,368,102	12	ATCTTTATTGTw	sACAATAAAGAT
0 annotated groups 0 'de novo' group(s)	70194	2.30E-01	CHROMOSOME_III:3,368,114-3,368,119	6	GTCGCG	CGCGAC
0 annotated groups 0 'de novo' group(s)	70193	9.10E-01	CHROMOSOME_III:3,368,119-3,368,132	14	GCGACAACCnACAC	GTGTnGGTTGTCGC
0 annotated groups 1 'de novo' group(s) 21	70192	5.78E-01	CHROMOSOME_III:3,368,132-3,368,145	14	AGAAGACGTCGATT	AATCGACGTCTTCT
1 annotated group(s): 50066 (PPARgamma) [2.73E-05] 1 'de novo' group(s) 40	70191	7.51E-01	CHROMOSOME_III:3,368,168-3,368,180	13	nnTGGCCTmCTGn	nCAGkAGGCCAnn
1 annotated group(s): 50066 (PPARgamma) [2.73E-05] 0 'de novo' group(s)	70190	9.57E-01	CHROMOSOME_III:3,368,179-3,368,197	19	AGACAATTATAGTTTGCnn	nnGCAAACTATAATTGTCT
0 annotated groups 0 'de novo' group(s)	70189	3.16E-01	CHROMOSOME_III:3,368,193-3,368,202	10	AAGTTnGGCG	CGCCnAACTT