Region for Gene K03C7.2b

This page describes one promoter-based search region.

The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.

The first track shows the location of the search region in red. The last track shows known gene locations in this 100000 bp span of the genome.

This promoter-based search region is located close to a particular gene of interest, described in the table below. Click on the gene id to open a page at ensembl.org with more information about this gene.

The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit. Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not any modules of that type exist, and if so, whether or not all the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)

User-specified filter settings do not affect the features displayed in the UCSC genome browser view.

About the patterns shown in this image:
There are no 'de novo' patterns to show.
There are no (TRANSFAC) annotation-based patterns to show.
There are no (JASPAR) annotation-based patterns to show.

Click on the image to view this region at UCSC.

This image uses the C.elegans genome assembly from Jan 2007. (UCSC ce4, WS170, Ensembl v45) and contains a number of custom tracks followed by several UCSC tracks. The custom tracks show: The long red and gray bar at the top shows the nominal 'search region' within which comparative genomics discovery methods were applied. Motif predictions were not made in coding exons and most types of repeats. In this database, the locations of masks applied to the search region are shown in gray. The numbered brown blocks are 'atomic' motifs, i.e. conserved DNA sequence motifs that were identified by discovery methods and post-processing operations. Motifs are shaded to indicate the discovery p-value; a darker motif was more significant at the discovery stage. Following the motif discovery stage, motifs were filtered by membership in co-occurring patterns, and patterns were ranked by genome-scale properties. Motifs instances that occur in highly-ranked putative regulatory modules may be more reliable predictions of functional genomic elements. The connected sets of blue boxes are co-occurring patterns, i.e. putative regulatory modules. Modules are shaded to indicate the number of times that a pattern is found in the target genome; a darker module is associated with more search regions. An pattern is called either 'de novo' or annotation-based, depending on the type of groups that appear in the pattern. (see next point) Before patterns (i.e. modules) can be identified from atomic motifs, groups of similar motifs must be found; modules are then identified as co-occurring 'group labels' that satisfy certain criteria. Such groups can be identified a) by annotating atomic motifs with known binding site resources from TRANSFAC, JASPAR or ORegAnno; or b) by 'de novo' clustering. Currently we show both types of patterns, but we consider annotation-based groups and patterns to be more reliable than 'de novo' groups and patterns. Work to improve genome-scale 'de novo' grouping is ongoing.

Showing 65 out of 65 atomic motifs.

Group(s) crtCele#(name) [p-value]	Motif craCele#	Discovery p-value	Location	Width	(+)motif	(-)motif
0 annotated groups 0 'de novo' group(s)	91053	1.00E-08	CHROMOSOME_X:3,820,586-3,820,591	6	CCTCTT	AAGAGG
2 annotated group(s): 30006 (CEH-10) [5.89E-05] 50072 (RORalfa-2) [9.78E-05] 0 'de novo' group(s)	91052	3.62E-01	CHROMOSOME_X:3,820,598-3,820,605	8	GAGGTAmT	AkTACCTC
0 annotated groups 2 'de novo' group(s) 154, 1160	91051	7.96E-01	CHROMOSOME_X:3,820,620-3,820,638	19	TCTrTGGTCATTTCCTTTC	GAAAGGAAATGACCAyAGA
0 annotated groups 0 'de novo' group(s)	91050	1.40E-01	CHROMOSOME_X:3,820,647-3,820,654	8	CCTCTTAT	ATAAGAGG
0 annotated groups 2 'de novo' group(s) 48, 420	91049	8.92E-01	CHROMOSOME_X:3,820,653-3,820,660	8	sATGGyCC	GGrCCATw
0 annotated groups 0 'de novo' group(s)	91048	4.74E-01	CHROMOSOME_X:3,820,670-3,820,677	8	CATGGTCC	GGACCATG
0 annotated groups 1 'de novo' group(s) 1176	91047	2.30E-01	CHROMOSOME_X:3,820,702-3,820,713	12	CCAAAACACTTT	AAAGTGTTTTGG
2 annotated group(s): 40086 (GCMa) [5.06E-06] 50073 (RREB-1) [2.62E-05] 0 'de novo' group(s)	91046	2.30E-01	CHROMOSOME_X:3,820,721-3,820,732	12	CCTCTTATTGCT	AGCAATAAGAGG
2 annotated group(s): 40086 (GCMa) [5.06E-06] 50073 (RREB-1) [2.62E-05] 1 'de novo' group(s) 33	91045	1.92E-01	CHROMOSOME_X:3,820,731-3,820,749	19	AACACAACTCCCACCAmCy	rGkTGGTGGGAGTTGTGTT
0 annotated groups 0 'de novo' group(s)	91044	1.00E-08	CHROMOSOME_X:3,820,753-3,820,760	8	CCAAACAG	CTGTTTGG
1 annotated group(s): 30009 (DAF-19) [1.39E-04] 2 'de novo' group(s) 205, 771	91042	8.11E-02	CHROMOSOME_X:3,820,759-3,820,796	38	CmyyTCGGCAAACTGTA...	TGAGCAAGTACCTCTTA...
2 annotated group(s): 40003 (AhR) [1.27E-07] 40003 (AhR) [2.29E-06] 3 'de novo' group(s) 5, 11, 103	91041	2.67E-01	CHROMOSOME_X:3,820,798-3,820,816	19	GTGTGCCAAGTCCCGCCCm	kGGGCGGGACTTGGCACAC
2 annotated group(s): 40003 (AhR) [1.27E-07] 40003 (AhR) [2.29E-06] 3 'de novo' group(s) 8, 11, 725	91040	7.86E-01	CHROMOSOME_X:3,820,810-3,820,821	12	TGyrTrCATGCC	GGCATGyAyrCA
0 annotated groups 1 'de novo' group(s) 25	91039	1.00E-08	CHROMOSOME_X:3,820,845-3,820,865	21	TTGTATGCTCTGTTTCT...	GTGCAGAAACAGAGCAT...
0 annotated groups 0 'de novo' group(s)	91038	4.59E-01	CHROMOSOME_X:3,820,872-3,820,889	18	AArATCATACGACATCAy	rTGATGTCGTATGATyTT
1 annotated group(s): 50073 (RREB-1) [2.48E-06] 2 'de novo' group(s) 374, 1291	91037	8.88E-01	CHROMOSOME_X:3,820,898-3,820,913	16	GGCGGCCGGGGyTCAT	ATGArCCCCGGCCGCC
0 annotated groups 2 'de novo' group(s) 1, 82	91036	2.12E-01	CHROMOSOME_X:3,820,912-3,820,926	15	AAAAACTTGATAAGr	yCTTATCAAGTTTTT
0 annotated groups 0 'de novo' group(s)	91035	1.40E-01	CHROMOSOME_X:3,820,931-3,820,938	8	CACTTTGC	GCAAAGTG
1 annotated group(s): 40038 (Cdc5) [1.27E-06] 0 'de novo' group(s)	91034	4.69E-01	CHROMOSOME_X:3,820,935-3,820,950	16	ArGAAACTTTATCACT	AGTGATAAAGTTTCyT
1 annotated group(s): 40019 (ATF3) [5.83E-06] 0 'de novo' group(s)	91033	4.94E-01	CHROMOSOME_X:3,820,979-3,820,997	19	wnTGTGATGTCACAyCAAA	TTTGrTGTGACATCACAns
0 annotated groups 2 'de novo' group(s) 10, 148	91032	5.54E-01	CHROMOSOME_X:3,821,006-3,821,023	18	TTGAAATATGCATGnTTy	rAAnCATGCATATTTCAA
0 annotated groups 0 'de novo' group(s)	91031	9.42E-01	CHROMOSOME_X:3,821,043-3,821,062	20	TGCATTCAGTCAGGCATGTA	TACATGCCTGACTGAATGCA
1 annotated group(s): 50092 (Thing1-E47) [1.34E-05] 0 'de novo' group(s)	91029	1.00E-08	CHROMOSOME_X:3,821,068-3,821,091	24	GATGAAACATGCAAAGT...	CCAAAACACTTTGCATG...
0 annotated groups 0 'de novo' group(s)	91028	3.81E-01	CHROMOSOME_X:3,821,088-3,821,110	23	CGTTAAAGTTCTTCCTC...	CATCTyGAGGAAGAACT...
0 annotated groups 1 'de novo' group(s) 1306	91027	4.68E-01	CHROMOSOME_X:3,821,122-3,821,133	12	CCCCrGCysCCC	GGGwrGCyGGGG
0 annotated groups 2 'de novo' group(s) 68, 535	91026	1.74E-01	CHROMOSOME_X:3,821,131-3,821,140	10	GCCAAGTCCC	GGGACTTGGC
2 annotated group(s): 50014 (Bsap) [7.41E-06] 40154 (Pax-5) [8.48E-06] 3 'de novo' group(s) 292, 819, 1778	91024	5.76E-02	CHROMOSOME_X:3,821,137-3,821,178	42	TTTGTTCCGCTCTACCA...	GGACTCAAACGGCCAAA...
0 annotated groups 2 'de novo' group(s) 71, 1885	91023	4.52E-02	CHROMOSOME_X:3,821,191-3,821,219	29	TTCATAGAAAGGAAATG...	ACATTCTGTGGTCATTT...
0 annotated groups 0 'de novo' group(s)	91022	4.40E-01	CHROMOSOME_X:3,821,225-3,821,234	10	wCGGGAmTmA	TkAkTCCCGs
0 annotated groups 0 'de novo' group(s)	91021	3.42E-01	CHROMOSOME_X:3,821,231-3,821,240	10	TGAGCCCCGr	yCGGGGCTCA
0 annotated groups 0 'de novo' group(s)	91020	1.00E-08	CHROMOSOME_X:3,821,238-3,821,244	7	CCTCTTA	TAAGAGG
0 annotated groups 0 'de novo' group(s)	91019	4.59E-01	CHROMOSOME_X:3,821,243-3,821,256	14	TCCTATCTCTCsyy	rrwGAGAGATAGGA
0 annotated groups 0 'de novo' group(s)	91018	5.99E-01	CHROMOSOME_X:3,821,319-3,821,328	10	GTGCCAAGTs	wACTTGGCAC
0 annotated groups 0 'de novo' group(s)	91017	1.00E-08	CHROMOSOME_X:3,821,326-3,821,331	6	GTTGTG	CACAAC
0 annotated groups 0 'de novo' group(s)	91016	5.78E-01	CHROMOSOME_X:3,821,329-3,821,342	14	TACCTCTTATTGCT	AGCAATAAGAGGTA
0 annotated groups 0 'de novo' group(s)	91015	1.40E-01	CHROMOSOME_X:3,821,339-3,821,346	8	CACTTTGC	GCAAAGTG
0 annotated groups 0 'de novo' group(s)	91014	5.75E-01	CHROMOSOME_X:3,821,404-3,821,417	14	AGAAACTTTATCAm	kTGATAAAGTTTCT
0 annotated groups 4 'de novo' group(s) 6, 79, 1127, 3014	91013	7.57E-01	CHROMOSOME_X:3,821,424-3,821,438	15	TACGGTAGyTnyykw	smrrnArCTACCGTA
1 annotated group(s): 40134 (NF-kappaB) [5.08E-07] 0 'de novo' group(s)	91012	8.75E-01	CHROMOSOME_X:3,821,437-3,821,453	17	GACTGAATGCAAAACAA	TTGTTTTGCATTCAGTC
3 annotated group(s): 40134 (NF-kappaB) [5.08E-07] 40094 (HMG_I) [4.82E-06] 50107 (p65) [5.03E-05] 0 'de novo' group(s)	91011	6.10E-01	CHROMOSOME_X:3,821,457-3,821,466	10	AAkAGGTAyT	ArTACCTmTT
0 annotated groups 0 'de novo' group(s)	91010	5.78E-01	CHROMOSOME_X:3,821,468-3,821,481	14	GTAGCAATAAGAGG	CCTCTTATTGCTAC
0 annotated groups 0 'de novo' group(s)	91009	1.00E-08	CHROMOSOME_X:3,821,504-3,821,509	6	TGATGT	ACATCA
0 annotated groups 0 'de novo' group(s)	91008	3.16E-01	CHROMOSOME_X:3,821,507-3,821,516	10	ACATGCCTGA	TCAGGCATGT
0 annotated groups 0 'de novo' group(s)	91007	3.62E-01	CHROMOSOME_X:3,821,531-3,821,538	8	CAAGTmCC	GGkACTTG
0 annotated groups 0 'de novo' group(s)	91006	4.74E-01	CHROMOSOME_X:3,821,554-3,821,561	8	CTTTGCAT	ATGCAAAG
0 annotated groups 0 'de novo' group(s)	91005	2.30E-01	CHROMOSOME_X:3,821,565-3,821,570	6	CATACA	TGTATG
0 annotated groups 0 'de novo' group(s)	91004	5.16E-01	CHROMOSOME_X:3,821,572-3,821,585	14	mTTTryATCTTTmA	TkAAAGATryAAAk
0 annotated groups 0 'de novo' group(s)	91003	7.72E-01	CHROMOSOME_X:3,821,609-3,821,622	14	GTAGmAATArGAGG	CCTCyTATTkCTAC
0 annotated groups 1 'de novo' group(s) 10	91002	3.12E-01	CHROMOSOME_X:3,821,623-3,821,632	10	AAAAkCATrC	GyATGmTTTT
1 annotated group(s): 50048 (Hen-1) [3.85E-05] 2 'de novo' group(s) 22, 212	91001	6.59E-02	CHROMOSOME_X:3,821,635-3,821,645	11	GAGCAGCTGCA	TGCAGCTGCTC
0 annotated groups 0 'de novo' group(s)	91000	8.14E-01	CHROMOSOME_X:3,821,646-3,821,660	15	CCGGsCGsCnsGrGy	rCyCwnGwCGwCCGG
2 annotated group(s): 50007 (Androgen) [1.99E-05] 50073 (RREB-1) [5.30E-05] 1 'de novo' group(s) 8	90999	3.72E-01	CHROMOSOME_X:3,821,691-3,821,704	14	GTATGCTCTGTTTC	GAAACAGAGCATAC
2 annotated group(s): 50106 (p53) [3.12E-05] 50073 (RREB-1) [5.30E-05] 0 'de novo' group(s)	90998	1.00E-08	CHROMOSOME_X:3,821,704-3,821,709	6	TGTATG	CATACA
2 annotated group(s): 50106 (p53) [3.12E-05] 50073 (RREB-1) [5.30E-05] 0 'de novo' group(s)	90997	3.16E-01	CHROMOSOME_X:3,821,710-3,821,719	10	CAGATGGAAG	CTTCCATCTG
1 annotated group(s): 50007 (Androgen) [4.73E-05] 5 'de novo' group(s) 43, 46, 68, 225, 833	90996	9.24E-01	CHROMOSOME_X:3,821,735-3,821,757	23	CsGGGCGGCCGGGGCTy...	AAAAAkrAGCCCCGGCC...
0 annotated groups 2 'de novo' group(s) 75, 452	90995	1.89E-01	CHROMOSOME_X:3,821,762-3,821,791	30	ACAGACCCCTAGGGGCC...	TTCAGATATGGATGGCC...
2 annotated group(s): 40096 (HNF-3) [6.62E-06] 40014 (AP-2alphaA) [9.02E-06] 5 'de novo' group(s) 25, 59, 283, 1295, 2173	90991	1.00E-08	CHROMOSOME_X:3,821,844-3,821,902	59	TGTGTGTTTGTTTTGCA...	TTTCAAATTGCTTGCCT...
3 annotated group(s): 40131 (NF-1) [5.03E-06] 40197 (Tal-1) [5.30E-06] 50091 (Tal1beta-E47S) [3.47E-05] 2 'de novo' group(s) 57, 320	90989	4.14E-02	CHROMOSOME_X:3,821,906-3,821,933	28	GGCTCTCGCCCTATTTC...	ACAGATGGAAGGAAATA...
1 annotated group(s): 40131 (NF-1) [5.03E-06] 0 'de novo' group(s)	90988	2.64E-01	CHROMOSOME_X:3,821,927-3,821,938	12	TTCCTGGCTCTC	GAGAGCCAGGAA
1 annotated group(s): 40131 (NF-1) [5.03E-06] 9 'de novo' group(s) 5, 45, 60, 67, 109, 150, 222, 829, 3258	90987	7.49E-01	CHROMOSOME_X:3,821,942-3,821,984	43	GsrkGnAGGGACCATGT...	GrrCCCCGGCCGCCCwG...
1 annotated group(s): 50091 (Tal1beta-E47S) [8.78E-05] 3 'de novo' group(s) 139, 787, 2632	90986	8.73E-01	CHROMOSOME_X:3,821,983-3,822,004	22	TnkrGCAAGGACAGGAT...	yCmrGATCCTGTCCTTG...
1 annotated group(s): 50073 (RREB-1) [6.47E-05] 2 'de novo' group(s) 292, 819	90985	5.92E-01	CHROMOSOME_X:3,822,003-3,822,019	17	CCrrTyGGCTGTTTGGC	GCCAAACAGCCrAyyGG
1 annotated group(s): 50073 (RREB-1) [6.47E-05] 0 'de novo' group(s)	90984	8.64E-01	CHROMOSOME_X:3,822,022-3,822,035	14	mAGACCCCTAGrGG	CCyCTAGGGGTCTk
1 annotated group(s): 50106 (p53) [9.66E-05] 1 'de novo' group(s) 51	90983	9.58E-01	CHROMOSOME_X:3,822,037-3,822,050	14	GrAskACAkGrTCC	GGAyCmTGTmwTyC
0 annotated groups 0 'de novo' group(s)	90982	1.00E-08	CHROMOSOME_X:3,822,067-3,822,074	8	CTTTGCAT	ATGCAAAG