Region for Gene T23F2.1

This page describes one promoter-based search region.

The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.

The first track shows the location of the search region in red. The last track shows known gene locations in this 100000 bp span of the genome.

This promoter-based search region is located close to a particular gene of interest, described in the table below. Click on the gene id to open a page at ensembl.org with more information about this gene.

The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit. Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not any modules of that type exist, and if so, whether or not all the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)

User-specified filter settings do not affect the features displayed in the UCSC genome browser view.

About the patterns shown in this image:
There are no 'de novo' patterns to show.
There are no (TRANSFAC) annotation-based patterns to show.
There are no (JASPAR) annotation-based patterns to show.

Click on the image to view this region at UCSC.

This image uses the C.elegans genome assembly from Jan 2007. (UCSC ce4, WS170, Ensembl v45) and contains a number of custom tracks followed by several UCSC tracks. The custom tracks show: The long red and gray bar at the top shows the nominal 'search region' within which comparative genomics discovery methods were applied. Motif predictions were not made in coding exons and most types of repeats. In this database, the locations of masks applied to the search region are shown in gray. The numbered brown blocks are 'atomic' motifs, i.e. conserved DNA sequence motifs that were identified by discovery methods and post-processing operations. Motifs are shaded to indicate the discovery p-value; a darker motif was more significant at the discovery stage. Following the motif discovery stage, motifs were filtered by membership in co-occurring patterns, and patterns were ranked by genome-scale properties. Motifs instances that occur in highly-ranked putative regulatory modules may be more reliable predictions of functional genomic elements. The connected sets of blue boxes are co-occurring patterns, i.e. putative regulatory modules. Modules are shaded to indicate the number of times that a pattern is found in the target genome; a darker module is associated with more search regions. An pattern is called either 'de novo' or annotation-based, depending on the type of groups that appear in the pattern. (see next point) Before patterns (i.e. modules) can be identified from atomic motifs, groups of similar motifs must be found; modules are then identified as co-occurring 'group labels' that satisfy certain criteria. Such groups can be identified a) by annotating atomic motifs with known binding site resources from TRANSFAC, JASPAR or ORegAnno; or b) by 'de novo' clustering. Currently we show both types of patterns, but we consider annotation-based groups and patterns to be more reliable than 'de novo' groups and patterns. Work to improve genome-scale 'de novo' grouping is ongoing.

Showing 58 out of 58 atomic motifs.

Group(s) crtCele#(name) [p-value]	Motif craCele#	Discovery p-value	Location	Width	(+)motif	(-)motif
2 annotated group(s): 50043 (HLF) [2.86E-05] 50076 (SAP-1) [3.88E-05] 2 'de novo' group(s) 153, 1180	123517	7.86E-01	CHROMOSOME_X:5,491,964-5,491,977	14	GCCGGCAGATGGAT	ATCCATCTGCCGGC
0 annotated groups 0 'de novo' group(s)	123518	9.84E-02	CHROMOSOME_X:5,491,983-5,491,988	6	AGCCTA	TAGGCT
0 annotated groups 0 'de novo' group(s)	123519	1.40E-01	CHROMOSOME_X:5,492,031-5,492,038	8	TTCCTAGG	CCTAGGAA
0 annotated groups 0 'de novo' group(s)	123520	9.95E-01	CHROMOSOME_X:5,492,333-5,492,342	10	CAGCATAGCC	GGCTATGCTG
0 annotated groups 0 'de novo' group(s)	123521	4.74E-01	CHROMOSOME_X:5,492,375-5,492,382	8	CCGwCTnT	AnAGsCGG
1 annotated group(s): 50106 (p53) [3.14E-05] 0 'de novo' group(s)	123522	7.78E-01	CHROMOSOME_X:5,492,494-5,492,501	8	GGATGCrC	GyGCATCC
2 annotated group(s): 40151 (p53) [2.04E-06] 50106 (p53) [3.19E-06] 3 'de novo' group(s) 55, 133, 627	123523	9.43E-01	CHROMOSOME_X:5,492,568-5,492,596	29	ysyGymCCGTAGCCTAC...	TTsTwnAGACATGTAGG...
0 annotated groups 0 'de novo' group(s)	123524	5.48E-01	CHROMOSOME_X:5,492,632-5,492,639	8	CTATGCTG	CAGCATAG
0 annotated groups 0 'de novo' group(s)	123525	7.66E-01	CHROMOSOME_X:5,492,638-5,492,645	8	TGTCGGmC	GkCCGACA
0 annotated groups 1 'de novo' group(s) 38	123526	8.74E-01	CHROMOSOME_X:5,492,648-5,492,662	15	AAACGTGCGGAATCC	GGATTCCGCACGTTT
1 annotated group(s): 50019 (Chop-cEBP) [1.47E-05] 2 'de novo' group(s) 628, 2242	123527	9.06E-01	CHROMOSOME_X:5,492,656-5,492,675	20	GGAATCCGTACGATTTGCAC	GTGCAAATCGTACGGATTCC
1 annotated group(s): 40014 (AP-2alphaA) [9.04E-06] 0 'de novo' group(s)	123528	3.50E-01	CHROMOSOME_X:5,492,691-5,492,703	13	nTCATsTCCyTkC	GmArGGAwATGAn
1 annotated group(s): 40014 (AP-2alphaA) [9.04E-06] 0 'de novo' group(s)	123529	8.00E-01	CHROMOSOME_X:5,492,707-5,492,721	15	wCssmATCTCAAAAT	ATTTTGAGATkwwGs
0 annotated groups 2 'de novo' group(s) 55, 2277	123530	4.01E-01	CHROMOSOME_X:5,492,730-5,492,752	23	GTTTTTAATCTGTAGCC...	sksTGAGGCTACAGATT...
0 annotated groups 0 'de novo' group(s)	123531	6.73E-01	CHROMOSOME_X:5,492,755-5,492,760	6	CGCACG	CGTGCG
0 annotated groups 1 'de novo' group(s) 36	123532	7.56E-01	CHROMOSOME_X:5,492,776-5,492,790	15	CCmCGGACCAGAAGC	GCTTCTGGTCCGkGG
1 annotated group(s): 30003 (15492775-EARLY-1) [5.25E-05] 0 'de novo' group(s)	123533	3.70E-01	CHROMOSOME_X:5,492,791-5,492,810	20	nnGGAGACGGAGAGAAAGCA	TGCTTTCTCTCCGTCTCCnn
0 annotated groups 1 'de novo' group(s) 191	123534	5.90E-01	CHROMOSOME_X:5,492,808-5,492,820	13	GmAGkGrGATGAC	GTCATCyCmCTkC
0 annotated groups 0 'de novo' group(s)	123535	5.34E-01	CHROMOSOME_X:5,492,818-5,492,829	12	GACTTTCATTGA	TCAATGAAAGTC
0 annotated groups 4 'de novo' group(s) 5, 84, 909, 1627	123536	3.79E-01	CHROMOSOME_X:5,492,827-5,492,844	18	TTGAGGGCGGAGTGAAAC	GTTTCACTCCGCCCTCAA
0 annotated groups 0 'de novo' group(s)	123537	2.60E-01	CHROMOSOME_X:5,492,837-5,492,850	14	AGTGAAACTCTGTT	AACAGAGTTTCACT
0 annotated groups 0 'de novo' group(s)	123538	4.47E-01	CHROMOSOME_X:5,492,854-5,492,884	31	AACAAGATTTTCGGTAT...	CCGAATGTCGGCCAATA...
0 annotated groups 2 'de novo' group(s) 5, 84	123539	4.60E-01	CHROMOSOME_X:5,492,884-5,492,895	12	GGGCGGAGyTTC	GAArCTCCGCCC
0 annotated groups 2 'de novo' group(s) 28, 2868	123541	9.18E-01	CHROMOSOME_X:5,492,895-5,492,921	27	yTnnTTwTCCrAGGACT...	GCGCAATTCGAGTCCTy...
0 annotated groups 0 'de novo' group(s)	123540	1.00E-08	CHROMOSOME_X:5,492,911-5,492,916	6	TCGAAT	ATTCGA
0 annotated groups 3 'de novo' group(s) 1429, 2639, 1763	123542	7.68E-01	CHROMOSOME_X:5,492,916-5,492,939	24	TTGCGCCTCATCCCGTC...	rAGGGACGACGGGATGA...
1 annotated group(s): 50007 (Androgen) [2.17E-05] 0 'de novo' group(s)	123543	5.63E-02	CHROMOSOME_X:5,492,937-5,492,944	8	CTCATTTC	GAAATGAG
2 annotated group(s): 50014 (Bsap) [2.15E-05] 50007 (Androgen) [2.17E-05] 0 'de novo' group(s)	123544	4.03E-01	CHROMOSOME_X:5,492,948-5,492,973	26	CAGTGTTCGATATCGAA...	GACCGTCTATTCGATAT...
0 annotated groups 7 'de novo' group(s) 68, 308, 436, 462, 607, 2855, 2292	123545	2.98E-01	CHROMOSOME_X:5,492,967-5,493,007	41	GACGGTCTATTGTCGCA...	AGCACAGTCGGACTGCG...
0 annotated groups 1 'de novo' group(s) 75	123547	3.39E-01	CHROMOSOME_X:5,493,004-5,493,020	17	TGCTTTATCGCCATCCA	TGGATGGCGATAAAGCA
0 annotated groups 2 'de novo' group(s) 58, 75	123548	4.61E-01	CHROMOSOME_X:5,493,013-5,493,036	24	GCCATCCATCTGCCGGC...	GGAAGCAGCCGGCAGAT...
1 annotated group(s): 30009 (DAF-19) [3.40E-05] 1 'de novo' group(s) 2164	123549	6.88E-01	CHROMOSOME_X:5,493,036-5,493,056	21	CATTTCCTTGGGAACAG...	wACACTGTTCCCAAGGA...
0 annotated groups 1 'de novo' group(s) 1241	123550	4.21E-01	CHROMOSOME_X:5,493,052-5,493,089	38	GTGTCAGTTATCCCTTC...	GCGCTTyAGCTCGGAGA...
0 annotated groups 1 'de novo' group(s) 192	123552	3.92E-01	CHROMOSOME_X:5,493,086-5,493,095	10	GCGCTATTCG	CGAATAGCGC
2 annotated group(s): 40063 (E47) [1.75E-06] 50009 (Brachyury) [1.49E-05] 3 'de novo' group(s) 18, 537, 1941	123553	2.72E-01	CHROMOSOME_X:5,493,093-5,493,122	30	TCGrTTTTGTCTCTTTA...	AAGAGCGCAGGTGTAAA...
0 annotated groups 1 'de novo' group(s) 53	123555	4.08E-01	CHROMOSOME_X:5,493,119-5,493,135	17	TCTTTTCTTyTCCGTCC	GGACGGArAAGAAAAGA
0 annotated groups 2 'de novo' group(s) 53, 3259	123556	5.35E-01	CHROMOSOME_X:5,493,129-5,493,145	17	TCCGTyCCACTyTCTCT	AGAGArAGTGGrACGGA
4 annotated group(s): 40099 (HNF-4alpha1) [2.03E-06] 40105 (HSF1) [4.83E-06] 50017 (COUP-TF) [5.12E-05] ... 6 'de novo' group(s) 62, 275, 560, 1257, 3132, 2314	123557	3.59E-01	CHROMOSOME_X:5,493,147-5,493,182	36	nTyATCTGGTTCGTTCG...	TTCGGTACArAGCTCAC...
0 annotated groups 6 'de novo' group(s) 9, 57, 87, 189, 1048, 1815	123559	4.44E-01	CHROMOSOME_X:5,493,186-5,493,216	31	TCCGTCGCTGGCGAGAA...	AAAGTCTTACCTGCTTC...
0 annotated groups 0 'de novo' group(s)	123560	5.69E-01	CHROMOSOME_X:5,493,291-5,493,306	16	TTCAGCTCGGwGGArT	AyTCCsCCGAGCTGAA
0 annotated groups 0 'de novo' group(s)	123561	2.30E-01	CHROMOSOME_X:5,493,314-5,493,325	12	AArAAGAAACTC	GAGTTTCTTyTT
0 annotated groups 4 'de novo' group(s) 28, 399, 1339, 1765	123562	8.08E-01	CHROMOSOME_X:5,493,333-5,493,348	16	CCAACGAGTCCGCTws	wsAGCGGACTCGTTGG
0 annotated groups 1 'de novo' group(s) 1157	123563	3.34E-01	CHROMOSOME_X:5,493,348-5,493,373	26	GyCCCGATGTCCAGCTC...	TTCAATGTGGAGCTGGA...
0 annotated groups 0 'de novo' group(s)	123564	2.81E-01	CHROMOSOME_X:5,493,423-5,493,432	10	CCGAAATTCT	AGAATTTCGG
0 annotated groups 0 'de novo' group(s)	123565	2.30E-01	CHROMOSOME_X:5,493,447-5,493,452	6	GCGCTC	GAGCGC
1 annotated group(s): 50070 (Pbx) [8.35E-06] 0 'de novo' group(s)	123566	4.19E-01	CHROMOSOME_X:5,493,452-5,493,461	10	sCTGTmAATC	GATTkACAGw
2 annotated group(s): 40053 (DEAF-1) [9.43E-06] 50066 (PPARgamma) [9.40E-05] 0 'de novo' group(s)	123567	5.36E-01	CHROMOSOME_X:5,493,478-5,493,494	17	CGTGACTTTCCGTGACT	AGTCACGGAAAGTCACG
2 annotated group(s): 40053 (DEAF-1) [9.43E-06] 50066 (PPARgamma) [9.40E-05] 0 'de novo' group(s)	123568	6.88E-01	CHROMOSOME_X:5,493,487-5,493,508	22	CCGTGACTTTCACCTCw...	GrGGAsGAGGTGAAAGT...
0 annotated groups 1 'de novo' group(s) 1763	123569	6.67E-01	CHROMOSOME_X:5,493,515-5,493,536	22	TGTsTCATCTCCTTTCG...	GATGGCGAAAGGAGATG...
0 annotated groups 0 'de novo' group(s)	123570	3.87E-01	CHROMOSOME_X:5,493,529-5,493,545	17	TCGCCATCTCAAAATTG	CAATTTTGAGATGGCGA
0 annotated groups 0 'de novo' group(s)	123571	2.08E-01	CHROMOSOME_X:5,493,544-5,493,551	8	TGTTCCCA	TGGGAACA
0 annotated groups 0 'de novo' group(s)	123572	2.15E-01	CHROMOSOME_X:5,493,552-5,493,568	17	TTTCyTCCTTTTCCTTT	AAAGGAAAAGGArGAAA
1 annotated group(s): 40013 (AP-2) [4.81E-06] 1 'de novo' group(s) 1318	123573	2.76E-01	CHROMOSOME_X:5,493,576-5,493,592	17	GCTTTTTGTCGGCCCGC	GCGGGCCGACAAAAAGC
2 annotated group(s): 40013 (AP-2) [4.81E-06] 50029 (Evi-1) [9.96E-05] 4 'de novo' group(s) 31, 144, 145, 2805	123574	9.41E-01	CHROMOSOME_X:5,493,592-5,493,637	46	CTGTTTCGAATGCACTA...	rAAAAsTwGrATwwwwn...
0 annotated groups 1 'de novo' group(s) 2047	123575	8.56E-01	CHROMOSOME_X:5,493,654-5,493,667	14	CGCTCTAGATGCGA	TCGCATCTAGAGCG
0 annotated groups 0 'de novo' group(s)	123576	6.70E-01	CHROMOSOME_X:5,493,668-5,493,679	12	TCAGCATAGCCr	yGGCTATGCTGA
0 annotated groups 0 'de novo' group(s)	123577	9.33E-01	CHROMOSOME_X:5,493,677-5,493,686	10	CCGGCAGATG	CATCTGCCGG
0 annotated groups 0 'de novo' group(s)	123578	9.21E-01	CHROMOSOME_X:5,493,689-5,493,696	8	CACTAGTG	CACTAGTG