Region for Gene W01C8.6a

This page describes one promoter-based search region.

The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.

The first track shows the location of the search region in red. The last track shows known gene locations in this 100000 bp span of the genome.

This promoter-based search region is located close to a particular gene of interest, described in the table below. Click on the gene id to open a page at ensembl.org with more information about this gene.

The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit. Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not any modules of that type exist, and if so, whether or not all the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)

User-specified filter settings do not affect the features displayed in the UCSC genome browser view.

About the patterns shown in this image:
There are no 'de novo' patterns to show.
There are no (TRANSFAC) annotation-based patterns to show.
There are no (JASPAR) annotation-based patterns to show.

Click on the image to view this region at UCSC.

This image uses the C.elegans genome assembly from Jan 2007. (UCSC ce4, WS170, Ensembl v45) and contains a number of custom tracks followed by several UCSC tracks. The custom tracks show: The long red and gray bar at the top shows the nominal 'search region' within which comparative genomics discovery methods were applied. Motif predictions were not made in coding exons and most types of repeats. In this database, the locations of masks applied to the search region are shown in gray. The numbered brown blocks are 'atomic' motifs, i.e. conserved DNA sequence motifs that were identified by discovery methods and post-processing operations. Motifs are shaded to indicate the discovery p-value; a darker motif was more significant at the discovery stage. Following the motif discovery stage, motifs were filtered by membership in co-occurring patterns, and patterns were ranked by genome-scale properties. Motifs instances that occur in highly-ranked putative regulatory modules may be more reliable predictions of functional genomic elements. The connected sets of blue boxes are co-occurring patterns, i.e. putative regulatory modules. Modules are shaded to indicate the number of times that a pattern is found in the target genome; a darker module is associated with more search regions. An pattern is called either 'de novo' or annotation-based, depending on the type of groups that appear in the pattern. (see next point) Before patterns (i.e. modules) can be identified from atomic motifs, groups of similar motifs must be found; modules are then identified as co-occurring 'group labels' that satisfy certain criteria. Such groups can be identified a) by annotating atomic motifs with known binding site resources from TRANSFAC, JASPAR or ORegAnno; or b) by 'de novo' clustering. Currently we show both types of patterns, but we consider annotation-based groups and patterns to be more reliable than 'de novo' groups and patterns. Work to improve genome-scale 'de novo' grouping is ongoing.

Showing 37 out of 37 atomic motifs.

Group(s) crtCele#(name) [p-value]	Motif craCele#	Discovery p-value	Location	Width	(+)motif	(-)motif
0 annotated groups 0 'de novo' group(s)	127757	1.00E-01	CHROMOSOME_X:5,710,605-5,710,614	10	TCyCACArTT	AAyTGTGrGA
1 annotated group(s): 30010 (ELT-2) [1.12E-04] 0 'de novo' group(s)	127756	2.70E-01	CHROMOSOME_X:5,710,613-5,710,626	14	TGTTATCATAyTTC	GAArTATGATAACA
0 annotated groups 0 'de novo' group(s)	127755	4.64E-01	CHROMOSOME_X:5,710,671-5,710,676	6	GTrCGC	GCGyAC
0 annotated groups 2 'de novo' group(s) 489, 1213	127754	2.03E-01	CHROMOSOME_X:5,710,683-5,710,699	17	TTCAAACCGTGGGAACC	GGTTCCCACGGTTTGAA
0 annotated groups 1 'de novo' group(s) 148	127753	1.56E-01	CHROMOSOME_X:5,710,709-5,710,728	20	ATTAGGCATAAATAATACCA	TGGTATTATTTATGCCTAAT
0 annotated groups 3 'de novo' group(s) 49, 364, 2140	127752	2.59E-01	CHROMOSOME_X:5,710,767-5,710,795	29	AAyCGrGTGACATTCAA...	AnAGTCCCACAGTTGAA...
0 annotated groups 3 'de novo' group(s) 540, 800, 2080	127751	1.98E-01	CHROMOSOME_X:5,710,797-5,710,810	14	rnCTATAGTCATAA	TTATGACTATAGny
0 annotated groups 0 'de novo' group(s)	127750	3.92E-01	CHROMOSOME_X:5,710,836-5,710,849	14	TnCATATTTCACAA	TTGTGAAATATGnA
0 annotated groups 4 'de novo' group(s) 345, 990, 1859, 1993	127748	4.01E-02	CHROMOSOME_X:5,710,917-5,710,962	46	ATAGACAAAAATGCGAA...	AAGGGTGAACACTGGTA...
0 annotated groups 2 'de novo' group(s) 1367, 2001	127747	3.58E-01	CHROMOSOME_X:5,710,977-5,710,993	17	yCwATCTATTCCkGrAn	nTyCmGGAATAGATsGr
0 annotated groups 0 'de novo' group(s)	127746	2.85E-01	CHROMOSOME_X:5,711,044-5,711,059	16	GAGGrACATTymACkG	CmGTkrAATGTyCCTC
0 annotated groups 0 'de novo' group(s)	127745	2.12E-01	CHROMOSOME_X:5,711,073-5,711,088	16	TTGCGCCCACCTCTTT	AAAGAGGTGGGCGCAA
1 annotated group(s): 50062 (NRF-2) [1.89E-05] 3 'de novo' group(s) 702, 2676, 2022	127744	9.17E-02	CHROMOSOME_X:5,711,096-5,711,116	21	TTGTCTTCCGGTAGTGC...	ATTCGCACTACCGGAAG...
0 annotated groups 0 'de novo' group(s)	127743	5.30E-01	CHROMOSOME_X:5,711,117-5,711,133	17	TTTCTACTGTyAGAAAA	TTTTCTrACAGTAGAAA
0 annotated groups 2 'de novo' group(s) 1015, 1736	127742	3.16E-01	CHROMOSOME_X:5,711,133-5,711,147	15	TCTGTTGCGCCCACC	GGTGGGCGCAACAGA
1 annotated group(s): 30009 (DAF-19) [4.13E-05] 8 'de novo' group(s) 5, 539, 1196, 2633, 2656, 2117, 2312, 2335	127740	2.96E-02	CHROMOSOME_X:5,711,154-5,711,229	76	AGTGTGTGTTAAGCATT...	ACCAACGGGCGGAATGG...
1 annotated group(s): 40003 (AhR) [3.79E-06] 0 'de novo' group(s)	127739	1.00E-08	CHROMOSOME_X:5,711,227-5,711,234	8	GTGTGTGT	ACACACAC
1 annotated group(s): 40003 (AhR) [3.79E-06] 2 'de novo' group(s) 29, 564	127738	7.47E-02	CHROMOSOME_X:5,711,231-5,711,244	14	AAATAAGTGTGTGT	ACACACACTTATTT
0 annotated groups 1 'de novo' group(s) 2061	127737	4.40E-01	CHROMOSOME_X:5,711,256-5,711,274	19	nnGGGATTGTATTACAAAC	GTTTGTAATACAATCCCnn
1 annotated group(s): 50083 (SRF) [8.50E-05] 0 'de novo' group(s)	127736	1.00E-08	CHROMOSOME_X:5,711,278-5,711,285	8	AATGCTTA	TAAGCATT
0 annotated groups 0 'de novo' group(s)	127735	1.00E-08	CHROMOSOME_X:5,711,311-5,711,316	6	GTTACC	GGTAAC
2 annotated group(s): 40155 (Pax-6) [2.30E-06] 50069 (Pax6) [3.29E-06] 0 'de novo' group(s)	127734	1.40E-01	CHROMOSOME_X:5,711,499-5,711,506	8	TAATGCTT	AAGCATTA
1 annotated group(s): 30009 (DAF-19) [1.10E-04] 0 'de novo' group(s)	127733	3.16E-01	CHROMOSOME_X:5,711,509-5,711,518	10	CTATAGTCAT	ATGACTATAG
1 annotated group(s): 30009 (DAF-19) [1.10E-04] 0 'de novo' group(s)	127732	1.40E-01	CHROMOSOME_X:5,711,519-5,711,526	8	GTTCCCAC	GTGGGAAC
0 annotated groups 2 'de novo' group(s) 29, 1065	127731	7.51E-01	CHROMOSOME_X:5,711,553-5,711,565	13	mGnGTGACATTCA	TGAATGTCACnCk
0 annotated groups 1 'de novo' group(s) 19	127730	4.74E-01	CHROMOSOME_X:5,711,624-5,711,631	8	TGGGTAAC	GTTACCCA
0 annotated groups 0 'de novo' group(s)	127729	3.16E-01	CHROMOSOME_X:5,711,683-5,711,692	10	TTwTGACwAT	ATsGTCAsAA
0 annotated groups 0 'de novo' group(s)	127728	3.16E-01	CHROMOSOME_X:5,711,694-5,711,703	10	CTATAGTCAT	ATGACTATAG
0 annotated groups 0 'de novo' group(s)	127727	8.48E-01	CHROMOSOME_X:5,711,716-5,711,729	14	CGGTAkGAATCGkG	CmCGATTCmTACCG
0 annotated groups 1 'de novo' group(s) 354	127726	8.63E-01	CHROMOSOME_X:5,711,726-5,711,741	16	AnCGTGGGAACCmsmA	TkwkGGTTCCCACGnT
0 annotated groups 0 'de novo' group(s)	127725	5.38E-01	CHROMOSOME_X:5,711,746-5,711,756	11	GGTAGTGCGAA	TTCGCACTACC
0 annotated groups 0 'de novo' group(s)	127724	7.12E-01	CHROMOSOME_X:5,711,759-5,711,776	18	AGAGGTGGGCGCAACAGA	TCTGTTGCGCCCACCTCT
0 annotated groups 2 'de novo' group(s) 48, 233	127723	3.16E-01	CHROMOSOME_X:5,711,782-5,711,791	10	GGGTAACAAC	GTTGTTACCC
0 annotated groups 0 'de novo' group(s)	127722	4.64E-01	CHROMOSOME_X:5,711,796-5,711,801	6	GCGyAC	GTrCGC
0 annotated groups 0 'de novo' group(s)	127721	2.76E-01	CHROMOSOME_X:5,711,869-5,711,876	8	ACGTGrGC	GCyCACGT
0 annotated groups 2 'de novo' group(s) 25, 431	127720	1.40E-01	CHROMOSOME_X:5,711,907-5,711,914	8	AGCrTACT	AGTAyGCT
0 annotated groups 0 'de novo' group(s)	127719	3.16E-01	CHROMOSOME_X:5,712,217-5,712,226	10	ACTATAGTCA	TGACTATAGT