cisRED: cis-regulatory element database

cisRED > Human Stat1 ChIP-seq peaks (HeLa S3) > region. Stat1_PK_3

Region for Stat1 Peak: Stat1_PK_3

This page describes one search region that corresponds to a peak generated by chromatin immunoprecipication and massively parallel Solexa sequencing.

Page Contents

Overview
Genomic Context
Image of Motifs and Modules
Motifs Found in this Region

Search region overview
Search region location	chr20:48,342,323-48,342,923 (+) (601 bp)
Assembly	Human, Ensembl v35 (NCBI 35)
Region ID	Stat1_PK_3
Modules (Co-occurring motif patterns)	487 annotation-based module(s) No 'de novo' modules exist in this database.

Genomic Context: Human genome assembly from Aug 2004. (UCSC hg17, NCBI 35, Ensembl v35)

The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.

The first track shows the location of the search region in red.
The next two (or four) green tracks show the extent of the ChIP-seq data reported in this image, and the height of the ChIP-seq peaks located within that extent.
The last track shows known gene locations in this 100000 bp span of the genome.

This is a ChIP-seq-based search region and thus gene locations were not a factor in selecting the location of this region. However, the identity of any genes that overlap with, or are closest to, this search region are still of interest, and are described in the table below.

Gene near this search region
Ensembl ID	ENSG00000196396 (PTPN1) (NM_002827) transcripts: 1) ENST00000357040
Gene description	Tyrosine-protein phosphatase, non-receptor type 1 (EC 3.1.3.48) (Protein-tyrosine phosphatase 1B) (PTP-1B). [Source:Uniprot/SWISSPROT;Acc:P18031]
Gene type	protein_coding
Transcript location(s)	1) chr20: 48,560,298-48,634,489 (+) (74,192 bp)
Distance from the region's midpoint to each transcript's TSS and TTS:	1) to TSS: -217,673, to TTS: -291,864
Gene near this search region
Ensembl ID	ENSG00000185982 (DEFB128) (NM_001037732) transcripts: 1) ENST00000334391
Gene description	Beta-defensin 128 precursor (Beta-defensin 28) (DEFB-28). [Source:Uniprot/SWISSPROT;Acc:Q7Z7B8]
Gene type	protein_coding
Transcript location(s)	1) chr20: 116,527-118,264 (-) (1,738 bp)
Distance from the region's midpoint to each transcript's TSS and TTS:	1) to TSS: -48,224,359, to TTS: -48,226,096

The distance from a cisred search region to a gene, is measured from the center of the search region to either the transcription termination site (TTS) or the transcription start site (TSS), whichever is closer.
A distance is negative if the TTS/TTS is downstream of the search region's center, relative to the gene's strand.
A distance is positive if the TTS/TTS is upstream of the search region's center, relative to the gene's strand.

A transcript's location is always reported relative to the positive strand.

Image of Motifs and Modules

The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit. Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not any modules of that type exist, and if so, whether or not all the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)

User-specified filter settings do not affect the features displayed in the UCSC genome browser view.

About the patterns shown in this image:
Note: This search region contains more patterns than are displayed in this UCSC genome browser image.
There are no 'de novo' patterns to show.
Only the top 20 ranked (TRANSFAC) annotation-based patterns are shown.
There are no (JASPAR) annotation-based patterns to show.

Click on the image to view this region at UCSC.

This image uses the Human genome assembly from Aug 2004. (UCSC hg17, NCBI 35, Ensembl v35) and contains a number of custom tracks followed by several UCSC tracks. The custom tracks show:

The long red and gray bar at the top shows the nominal 'search region' within which comparative genomics discovery methods were applied. Motif predictions were not made in coding exons and most types of repeats. In this database, the locations of masks applied to the search region are shown in gray.

The numbered brown blocks are 'atomic' motifs, i.e. conserved DNA sequence motifs that were identified by discovery methods and post-processing operations. Motifs are shaded to indicate the discovery p-value; a darker motif was more significant at the discovery stage.

Following the motif discovery stage, motifs were filtered by membership in co-occurring patterns, and patterns were ranked by genome-scale properties. Motifs instances that occur in highly-ranked putative regulatory modules may be more reliable predictions of functional genomic elements.

The connected sets of blue boxes are co-occurring patterns, i.e. putative regulatory modules. Modules are shaded to indicate the number of times that a pattern is found in the target genome; a darker module is associated with more search regions. An pattern is called either 'de novo' or annotation-based, depending on the type of groups that appear in the pattern. (see next point)

Before patterns (i.e. modules) can be identified from atomic motifs, groups of similar motifs must be found; modules are then identified as co-occurring 'group labels' that satisfy certain criteria. Such groups can be identified a) by annotating atomic motifs with known binding site resources from TRANSFAC, JASPAR or ORegAnno; or b) by 'de novo' clustering. Currently we show both types of patterns, but we consider annotation-based groups and patterns to be more reliable than 'de novo' groups and patterns. Work to improve genome-scale 'de novo' grouping is ongoing.

Motifs Found in this Region

The contents of the table below can be modified by changing your filter settings.
Currently, this table only contains motifs which:
+ have a discovery p-value < 1.0
+ were found using any of these algorithms: MotifSampler, Consensus.oops, Consensus.omops, Consensus.zmops, MEME.tcm, MEME.oops, MEME.zoops

Showing 26 out of 26 atomic motifs.

Group(s) crtHsap#(name) [p-value]	Motif craHsap#	Discovery p-value	Location	Width	(+)motif	(-)motif
3 annotated group(s): 10066 (PPARgamma) [2.48E-04] 200261 (Olf-1) [4.57E-04] 200983 (Bach1) [6.57E-04]	4242	1.00E-08	chr20:48,342,468-48,342,480	13	CCAGGCTGCCCTG	CAGGGCAGCCTGG
3 annotated group(s): 200808 (Pax-1) [2.49E-04] 200761 (DeltaNp63alpha) [2.66E-04] 200054 (NF-kappaB) [9.48E-04]	4243	1.00E-08	chr20:48,342,479-48,342,494	16	TGGGAGGTGCCAGCCy	rGGCTGGCACCTCCCA
7 annotated group(s): 201045 (AP-2alphaA) [1.58E-04] 200023 (HOXA5) [1.91E-04] 201045 (AP-2alphaA) [5.23E-04] ...	4244	1.00E-08	chr20:48,342,506-48,342,511	6	GGGGGC	GCCCCC
1 annotated group(s): 200806 (CTF) [7.57E-04]	4246	1.00E-08	chr20:48,342,525-48,342,537	13	CCkkGGCCACCwG	CsGGTGGCCmmGG
2 annotated group(s): 201009 (HES-1) [5.30E-04] 200806 (CTF) [7.57E-04]	4245	2.91E-02	chr20:48,342,528-48,342,536	9	TGGCCACCA	TGGTGGCCA
0 annotated groups	4247	3.82E-02	chr20:48,342,557-48,342,568	12	GAGCTGCAGGCC	GGCCTGCAGCTC
1 annotated group(s): 200008 (Sp1) [8.51E-04]	4248	1.00E-08	chr20:48,342,563-48,342,575	13	CAGGsCCGCCCGG	CCGGGCGGwCCTG
0 annotated groups	4249	3.22E-02	chr20:48,342,573-48,342,583	11	CGGCTCAGCTG	CAGCTGAGCCG
4 annotated group(s): 200474 (FOXO1) [3.04E-04] 10031 (FREAC-4) [3.26E-04] 200098 (Pax-2) [3.44E-04] ...	4251	7.01E-02	chr20:48,342,600-48,342,611	12	AATCTGTTTACT	AGTAAACAGATT
0 annotated groups	4250	1.00E-08	chr20:48,342,604-48,342,615	12	TGTTTACTGAAC	GTTCAGTAAACA
0 annotated groups	4252	1.00E-08	chr20:48,342,605-48,342,616	12	GTTTACTGAACT	AGTTCAGTAAAC
10 annotated group(s): 10074 (RXR-VDR) [4.49E-06] 200964 (CAR) [1.34E-05] 200959 (ER-alpha) [2.66E-04] ...	4253	1.00E-08	chr20:48,342,610-48,342,629	20	CTGAACTGGCTGACCCCTTC	GAAGGGGTCAGCCAGTTCAG
10 annotated group(s): 10028 (Elk-1) [2.83E-04] 200457 (STAT5A) [3.32E-04] 200457 (STAT5A) [4.58E-04] ...	4254	1.00E-08	chr20:48,342,626-48,342,636	11	CTTCCGGGAAC	GTTCCCGGAAG
2 annotated group(s): 201009 (HES-1) [4.40E-04] 200457 (STAT5A) [5.43E-04]	4255	1.00E-08	chr20:48,342,636-48,342,648	13	CTCGGCCCAAGCT	AGCTTGGGCCGAG
8 annotated group(s): 200457 (STAT5A) [2.60E-04] 201048 (GAS) [4.35E-04] 201048 (GAS) [4.35E-04] ...	4256	1.00E-08	chr20:48,342,646-48,342,658	13	GCTTCCCAGAACT	AGTTCTGGGAAGC
6 annotated group(s): 200489 (Nkx6-2) [4.37E-04] 200436 (IPF1) [5.43E-04] 201001 (DEAF-1) [6.46E-04] ...	4257	1.00E-08	chr20:48,342,660-48,342,673	14	GGGTATTAATGACC	GGTCATTAATACCC
5 annotated group(s): 201029 (MITF) [2.91E-04] 10058 (Max) [7.88E-04] 10093 (USF) [7.90E-04] ...	4258	1.00E-08	chr20:48,342,673-48,342,687	15	CCGGAGCCACATGAC	GTCATGTGGCTCCGG
5 annotated group(s): 200821 (Nrf2) [1.70E-04] 200514 (ATF4) [2.85E-04] 200037 (NF-E2) [3.91E-04] ...	4259	1.00E-08	chr20:48,342,689-48,342,707	19	GAGCATGACACAGCAyTTT	AAArTGCTGTGTCATGCTC
0 annotated groups	4260	8.74E-02	chr20:48,342,706-48,342,717	12	TTTGGGCrCAAG	CTTGyGCCCAAA
3 annotated group(s): 201045 (AP-2alphaA) [2.65E-04] 200242 (PPAR-alpha) [5.05E-04] 200097 (Pax-6) [8.41E-04]	4261	1.00E-08	chr20:48,342,718-48,342,734	17	GCAGGGCCCAGAGGGGy	rCCCCTCTGGGCCCTGC
7 annotated group(s): 200466 (HIF-1) [3.56E-05] 200964 (CAR) [9.80E-05] 200466 (HIF-1) [1.42E-04] ...	4262	1.00E-08	chr20:48,342,730-48,342,745	16	GGGGyGCGTGGGGGCC	GGCCCCCACGCrCCCC
1 annotated group(s): 200731 (AML3) [9.33E-04]	4263	1.00E-08	chr20:48,342,741-48,342,752	12	GGGCyGCwGCCC	GGGCsGCrGCCC
3 annotated group(s): 200097 (Pax-6) [6.53E-04] 200008 (Sp1) [8.04E-04] 200807 (Egr-1) [9.42E-04]	4264	4.00E-02	chr20:48,342,754-48,342,760	7	GCCCCCA	TGGGGGC
6 annotated group(s): 200733 (Smad4) [3.05E-04] 200514 (ATF4) [3.38E-04] 200821 (Nrf2) [3.75E-04] ...	4265	1.00E-08	chr20:48,342,773-48,342,784	12	kGsTGwGTCAyC	GrTGACsCAwCm
1 annotated group(s): 200143 (Pax-5) [8.83E-04]	4266	1.00E-08	chr20:48,342,783-48,342,795	13	CCTGGGCCmCCTG	CAGGkGGCCCAGG
1 annotated group(s): 200792 (Smad1) [9.41E-04]	4267	1.00E-08	chr20:48,342,855-48,342,867	13	CmGGGCTGCCCTG	CAGGGCAGCCCkG