cisRED: cis-regulatory element database

cisRED > Human Stat1 ChIP-seq peaks (HeLa S3) > region. Stat1_PK_43

Region for Stat1 Peak: Stat1_PK_43

This page describes one search region that corresponds to a peak generated by chromatin immunoprecipication and massively parallel Solexa sequencing.

Page Contents

Overview
Genomic Context
Image of Motifs and Modules
Motifs Found in this Region

Search region overview
Search region location	chr15:64,882,341-64,882,941 (+) (601 bp)
Assembly	Human, Ensembl v35 (NCBI 35)
Region ID	Stat1_PK_43
Modules (Co-occurring motif patterns)	361 annotation-based module(s) No 'de novo' modules exist in this database.

Genomic Context: Human genome assembly from Aug 2004. (UCSC hg17, NCBI 35, Ensembl v35)

The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.

The first track shows the location of the search region in red.
The next two (or four) green tracks show the extent of the ChIP-seq data reported in this image, and the height of the ChIP-seq peaks located within that extent.
The last track shows known gene locations in this 100000 bp span of the genome.

This is a ChIP-seq-based search region and thus gene locations were not a factor in selecting the location of this region. However, the identity of any genes that overlap with, or are closest to, this search region are still of interest, and are described in the table below.

Gene near this search region
Ensembl ID	ENSG00000186821 transcripts: 1) ENST00000335172
Gene type	pseudogene
Transcript location(s)	1) chr15: 64,887,939-64,888,572 (+) (634 bp)
Distance from the region's midpoint to each transcript's TSS and TTS:	1) to TSS: -5,296, to TTS: -5,929
Gene near this search region
Ensembl ID	ENSG00000188403 transcripts: 1) ENST00000338912
Gene description	PREDICTED: similar to immunoglobulin heavy-chain-2 light-chain-2 VH segment [Source:RefSeq_peptide_predicted;Acc:XP_496025]
Gene type	protein_coding
Transcript location(s)	1) chr15: 18,429,923-18,438,485 (-) (8,563 bp)
Distance from the region's midpoint to each transcript's TSS and TTS:	1) to TSS: -46,444,156, to TTS: -46,452,718

The distance from a cisred search region to a gene, is measured from the center of the search region to either the transcription termination site (TTS) or the transcription start site (TSS), whichever is closer.
A distance is negative if the TTS/TTS is downstream of the search region's center, relative to the gene's strand.
A distance is positive if the TTS/TTS is upstream of the search region's center, relative to the gene's strand.

A transcript's location is always reported relative to the positive strand.

Image of Motifs and Modules

The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit. Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not any modules of that type exist, and if so, whether or not all the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)

User-specified filter settings do not affect the features displayed in the UCSC genome browser view.

About the patterns shown in this image:
Note: This search region contains more patterns than are displayed in this UCSC genome browser image.
There are no 'de novo' patterns to show.
Only the top 20 ranked (TRANSFAC) annotation-based patterns are shown.
There are no (JASPAR) annotation-based patterns to show.

Click on the image to view this region at UCSC.

This image uses the Human genome assembly from Aug 2004. (UCSC hg17, NCBI 35, Ensembl v35) and contains a number of custom tracks followed by several UCSC tracks. The custom tracks show:

The long red and gray bar at the top shows the nominal 'search region' within which comparative genomics discovery methods were applied. Motif predictions were not made in coding exons and most types of repeats. In this database, the locations of masks applied to the search region are shown in gray.

The numbered brown blocks are 'atomic' motifs, i.e. conserved DNA sequence motifs that were identified by discovery methods and post-processing operations. Motifs are shaded to indicate the discovery p-value; a darker motif was more significant at the discovery stage.

Following the motif discovery stage, motifs were filtered by membership in co-occurring patterns, and patterns were ranked by genome-scale properties. Motifs instances that occur in highly-ranked putative regulatory modules may be more reliable predictions of functional genomic elements.

The connected sets of blue boxes are co-occurring patterns, i.e. putative regulatory modules. Modules are shaded to indicate the number of times that a pattern is found in the target genome; a darker module is associated with more search regions. An pattern is called either 'de novo' or annotation-based, depending on the type of groups that appear in the pattern. (see next point)

Before patterns (i.e. modules) can be identified from atomic motifs, groups of similar motifs must be found; modules are then identified as co-occurring 'group labels' that satisfy certain criteria. Such groups can be identified a) by annotating atomic motifs with known binding site resources from TRANSFAC, JASPAR or ORegAnno; or b) by 'de novo' clustering. Currently we show both types of patterns, but we consider annotation-based groups and patterns to be more reliable than 'de novo' groups and patterns. Work to improve genome-scale 'de novo' grouping is ongoing.

Motifs Found in this Region

The contents of the table below can be modified by changing your filter settings.
Currently, this table only contains motifs which:
+ have a discovery p-value < 1.0
+ were found using any of these algorithms: MotifSampler, Consensus.oops, Consensus.omops, Consensus.zmops, MEME.tcm, MEME.oops, MEME.zoops

Showing 35 out of 35 atomic motifs.

Group(s) crtHsap#(name) [p-value]	Motif craHsap#	Discovery p-value	Location	Width	(+)motif	(-)motif
1 annotated group(s): 200002 (E47) [5.11E-04]	4584	6.98E-03	chr15:64,882,341-64,882,369	29	CCTTTCCTACAGTTGTG...	GCCTCACAAAGGCACAA...
0 annotated groups	4585	7.52E-03	chr15:64,882,368-64,882,379	12	GCCATTCCTTTT	AAAAGGAATGGC
3 annotated group(s): 200436 (IPF1) [3.54E-04] 200744 (POU1F1) [7.96E-04] 200436 (IPF1) [9.00E-04]	4586	1.00E-08	chr15:64,882,376-64,882,388	13	TTTTTAATAAAAG	CTTTTATTAAAAA
0 annotated groups	4590	1.00E-08	chr15:64,882,384-64,882,401	18	AAAAGCAAGCATTTCTGG	CCAGAAATGCTTGCTTTT
1 annotated group(s): 200145 (POU3F2) [6.89E-04]	4587	2.63E-01	chr15:64,882,388-64,882,395	8	GCAAGCAT	ATGCTTGC
0 annotated groups	4588	2.63E-01	chr15:64,882,389-64,882,396	8	CAAGCATT	AATGCTTG
1 annotated group(s): 200034 (p53) [2.77E-04]	4589	2.63E-01	chr15:64,882,390-64,882,397	8	AAGCATTT	AAATGCTT
1 annotated group(s): 200054 (NF-kappaB) [1.87E-04]	4591	2.98E-04	chr15:64,882,402-64,882,413	12	GGCTGGCCCTCC	GGAGGGCCAGCC
3 annotated group(s): 200059 (YY1) [9.56E-05] 10073 (RREB-1) [3.71E-04] 200999 (AIRE) [5.82E-04]	4592	4.06E-01	chr15:64,882,424-64,882,433	10	CACCATGGTG	CACCATGGTG
4 annotated group(s): 200257 (RREB-1) [3.58E-05] 200446 (Spz1) [2.15E-04] 10073 (RREB-1) [3.71E-04] ...	4593	4.41E-02	chr15:64,882,429-64,882,441	13	TGGTGGGTTGGGG	CCCCAACCCACCA
0 annotated groups	4594	3.98E-03	chr15:64,882,436-64,882,447	12	TTGGGGsCTCAG	CTGAGwCCCCAA
2 annotated group(s): 200766 (LXR-alpha_RXR-alpha) [3.69E-04] 200034 (p53) [8.55E-04]	4595	3.31E-01	chr15:64,882,443-64,882,454	12	CTCAGGCCnGGG	CCCnGGCCTGAG
2 annotated group(s): 200005 (AP-4) [2.18E-04] 200034 (p53) [8.55E-04]	4596	7.20E-04	chr15:64,882,448-64,882,459	12	GCCrGGGCTGGC	GCCAGCCCyGGC
0 annotated groups	4597	6.53E-02	chr15:64,882,505-64,882,516	12	TTGGGGCCCCTC	GAGGGGCCCCAA
1 annotated group(s): 200095 (CUTL1) [3.46E-04]	4598	3.72E-03	chr15:64,882,520-64,882,531	12	GGAATrGATTTG	CAAATCyATTCC
1 annotated group(s): 200056 (NF-1) [7.74E-04]	4600	1.90E-03	chr15:64,882,562-64,882,579	18	AGkTTGCCATGGAArTCT	AGAyTTCCATGGCAAmCT
1 annotated group(s): 200056 (NF-1) [7.74E-04]	4599	6.74E-03	chr15:64,882,564-64,882,573	10	GTTGCCATGG	CCATGGCAAC
1 annotated group(s): 200056 (NF-1) [7.74E-04]	4601	7.85E-02	chr15:64,882,577-64,882,584	8	TCTGCAGA	TCTGCAGA
1 annotated group(s): 200436 (IPF1) [9.00E-04]	4602	1.00E-08	chr15:64,882,589-64,882,601	13	TTyTCATTAAAmr	ykTTTAATGArAA
3 annotated group(s): 200005 (AP-4) [1.18E-04] 200693 (E12) [3.58E-04] 201028 (NRSF) [6.17E-04]	4603	4.68E-02	chr15:64,882,610-64,882,620	11	GCAGCAGCAGC	GCTGCTGCTGC
15 annotated group(s): 200737 (E2F-1_DP-2) [2.47E-04] 200024 (E2F) [3.79E-04] 10024 (E2F) [3.79E-04] ...	4604	1.00E-08	chr15:64,882,629-64,882,646	18	ATTTCCCGGAATCyGGGA	TCCCrGATTCCGGGAAAT
5 annotated group(s): 200983 (Bach1) [1.33E-04] 200037 (NF-E2) [2.93E-04] 200821 (Nrf2) [4.38E-04] ...	4605	1.00E-08	chr15:64,882,653-64,882,661	9	rTGAGTCAC	GTGACTCAy
2 annotated group(s): 200623 (Crx) [4.47E-04] 200240 (Nkx2-5) [8.43E-04]	4606	1.09E-03	chr15:64,882,664-64,882,675	12	GCCTGCTAAGkG	CmCTTAGCAGGC
4 annotated group(s): 200242 (PPAR-alpha) [2.90E-04] 200687 (NF-Y) [6.84E-04] 200938 (E2F-1) [7.92E-04] ...	4607	1.63E-01	chr15:64,882,677-64,882,691	15	GCCCTGCGTGGCCAC	GTGGCCACGCAGGGC
1 annotated group(s): 200938 (E2F-1) [8.66E-04]	4608	9.97E-03	chr15:64,882,691-64,882,702	12	yTGsGGCCCCws	wsGGGGCCwCAr
1 annotated group(s): 200032 (c-Ets-1) [2.76E-04]	4609	2.70E-01	chr15:64,882,704-64,882,716	13	CCAGGAGGCCTGG	CCAGGCCTCCTGG
2 annotated group(s): 200749 (SREBP-1) [7.02E-04] 200143 (Pax-5) [9.92E-04]	4610	3.92E-02	chr15:64,882,712-64,882,724	13	CCyGGArTsCrGG	CCyGwAyTCCrGG
2 annotated group(s): 200999 (AIRE) [3.58E-04] 200056 (NF-1) [7.32E-04]	4611	1.37E-03	chr15:64,882,743-64,882,754	12	rCCAGGCCAGCC	GGCTGGCCTGGy
0 annotated groups	4612	3.40E-02	chr15:64,882,767-64,882,779	13	CCCGswryCCAGG	CCTGGryswCGGG
11 annotated group(s): 200113 (CREB) [1.78E-05] 200924 (AP-1) [2.67E-05] 10018 (CREB) [2.67E-05] ...	4613	4.46E-02	chr15:64,882,775-64,882,794	20	CCAGGCTGACGCAGGCTCCA	TGGAGCCTGCGTCAGCCTGG
0 annotated groups	4614	3.46E-03	chr15:64,882,791-64,882,806	16	TCCAGGAATGCAAACA	TGTTTGCATTCCTGGA
2 annotated group(s): 200143 (Pax-5) [6.03E-04] 200480 (LUN-1) [7.94E-04]	4615	1.00E-08	chr15:64,882,801-64,882,813	13	CAAACAAAGCTGG	CCAGCTTTGTTTG
1 annotated group(s): 200072 (CP2) [8.79E-04]	4616	4.44E-02	chr15:64,882,822-64,882,834	13	GCCTTsTGAGGGC	GCCCTCAwAAGGC
3 annotated group(s): 200751 (AML1) [1.99E-04] 200751 (AML1) [4.46E-04] 200800 (AP-2) [6.61E-04]	4617	3.60E-02	chr15:64,882,877-64,882,888	12	GCCTGskrAGGG	CCCTymwCAGGC
0 annotated groups	4618	4.55E-02	chr15:64,882,891-64,882,902	12	TTGGGGCCTCAG	CTGAGGCCCCAA