This page describes one promoter-based search region.
Page ContentsOverviewGenomic Context Image of Motifs and Modules Motifs Found in this Region |
| Search region overview | |
| Search region location | chr1:168,129,518-168,132,206 (-) (2689 bp) |
|---|---|
| Human, Ensembl v40 (NCBI 36) | |
| Gene name | SCYL3 |
| Ensembl gene ID | ENSG00000000457 |
| Gene description | Protein-associating with the carboxyl-terminal domain of ezrin (Ezrin- binding protein PACE-1) (SCY1-like protein 3). [Source:Uniprot/SWISSPROT;Acc:Q8IZE3] |
| Gene description source | HGNC Symbol |
| Modules |
3 annotation-based module(s)
No 'de novo' modules exist in this database. |
Genomic Context: Human genome assembly from Mar 2006. (UCSC hg18, NCBI 36, Ensembl v40)
The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.
|
|
This promoter-based search region is located close to a particular gene of interest, described in the table below. Click on the gene id to open a page at ensembl.org with more information about this gene.
| Target gene used to create this search region | |
| Ensembl ID | ENSG00000000457 (SCYL3) |
|---|---|
| Ensembl Transcript ID | ENST00000367771 |
| Gene description | Protein-associating with the carboxyl-terminal domain of ezrin (Ezrin- binding protein PACE-1) (SCY1-like protein 3). [Source:Uniprot/SWISSPROT;Acc:Q8IZE3] |
| Gene type | protein_coding |
| Gene location | chr1: 168,088,839-168,129,717 (-) (40,879 bp) |
| -1145 | |
|
The distance from a cisred search region to a gene, is measured from the center of the search region
to either the transcription termination site (TTS) or the transcription start site (TSS), whichever is closer.
A distance is negative if the TTS/TTS is downstream of the search region's center, relative to the gene's strand. A distance is positive if the TTS/TTS is upstream of the search region's center, relative to the gene's strand. A transcript's location is always reported relative to the positive strand. |
Image of Motifs and Modules
The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit.
Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not
any modules of that type exist, and if so, whether or not all
the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)
User-specified filter settings do not affect the features displayed in the UCSC genome browser view.
About the patterns shown in this image:
There are no 'de novo' patterns to show.
All instances of each (TRANSFAC) annotation-based pattern are shown.
There are no (JASPAR) annotation-based patterns to show.
Motifs Found in this Region
Currently, this table only contains motifs which:
+ have a discovery p-value < 0.1
+ were found using any of these algorithms: MotifSampler, Consensus.oops, Consensus.omops, Consensus.zmops, MEME.tcm, MEME.oops, MEME.zoops
Showing 13 out of 13 atomic motifs.
| Group(s) crtHsap#(name) [p-value] |
craHsap# |
Discovery p-value |
Location | Width | (+)motif | (-)motif |
|---|---|---|---|---|---|---|
|
2 annotated group(s): 40212 (ZEB_(1124_AA)) [1.96E-04] 40086 (GCMa) [9.38E-04] |
13 | 6.27E-02 | chr1:168,129,544-168,129,559 | 16 |
CCCGCAGGTAACmGGG |
CCCkGTTACCTGCGGG |
|
1 annotated group(s): 40204 (TFII-I) [8.53E-04] |
12 | 9.24E-04 | chr1:168,129,688-168,129,708 | 21 |
CCGTCTCTATGGTGTCG... |
yCTCCGACACCATAGAG... |
|
1 annotated group(s): 40211 (YY1) [5.09E-04] |
11 | 1.00E-02 | chr1:168,129,694-168,129,705 | 12 |
TCTCTATGGTGT |
ACACCATAGAGA |
|
1 annotated group(s): 40151 (p53) [7.87E-04] |
10 | 5.01E-04 | chr1:168,129,706-168,129,715 | 10 |
yCCGGAmCCG |
CGGkTCCGGr |
|
3 annotated group(s): 40068 (Elk-1) [2.54E-05] 40026 (c-Ets-1) [1.14E-04] 40151 (p53) [7.87E-04] |
9 | 5.01E-04 | chr1:168,129,712-168,129,719 | 8 |
CGkTTCCG |
CGGAAmCG |
|
1 annotated group(s): 40151 (p53) [7.87E-04] |
8 | 5.01E-04 | chr1:168,129,713-168,129,722 | 10 |
TCCCGkTTCC |
GGAAmCGGGA |
|
2 annotated group(s): 40204 (TFII-I) [1.26E-04] 40189 (Spz1) [9.29E-04] |
7 | 3.22E-02 | chr1:168,129,736-168,129,747 | 12 |
mkkwGGGmGGAA |
TTCCkCCCsmmk |
|
2 annotated group(s): 40018 (ATF-1) [1.98E-04] 40065 (E4F1) [2.67E-04] |
6 | 9.15E-04 | chr1:168,129,741-168,129,757 | 17 |
TyGrTGGyGTCGGAGGn |
nCCTCCGACrCCAyCrA |
|
1 annotated group(s): 40065 (E4F1) [2.67E-04] |
3 | 3.42E-02 | chr1:168,129,745-168,129,756 | 12 |
TGGTGkCGkCkG |
CmGmCGmCACCA |
|
2 annotated group(s): 40018 (ATF-1) [1.98E-04] 40065 (E4F1) [2.67E-04] |
5 | 5.01E-04 | chr1:168,129,745-168,129,752 | 8 |
GGykCCGG |
CCGGmrCC |
|
2 annotated group(s): 40018 (ATF-1) [1.98E-04] 40065 (E4F1) [2.67E-04] |
4 | 5.01E-04 | chr1:168,129,746-168,129,753 | 8 |
TGGyGTCG |
CGACrCCA |
|
3 annotated group(s): 40193 (STAT1) [2.46E-04] 40130 (NERF-1a) [6.20E-04] 40068 (Elk-1) [6.31E-04] |
2 | 5.01E-04 | chr1:168,129,772-168,129,781 | 10 |
TCGGTTCCGG |
CCGGAACCGA |
|
2 annotated group(s): 40066 (Egr-1) [4.19E-04] 40060 (E2F-1_DP-2) [5.91E-04] |
1 | 3.68E-02 | chr1:168,129,978-168,129,997 | 20 |
ATTTTGGATTCGGGCGGAAA |
TTTCCGCCCGAATCCAAAAT |

