FILTERS:
pvalue:0.1
Region for Gene ENSG00000003147 (HGNC Symbol: ICA1)
Go to Ensembl.org Go to UCSC

This page describes one promoter-based search region.

Page Contents

Overview
Genomic Context
Image of Motifs and Modules
Motifs Found in this Region
Search region overview
Search region location chr7:8,268,511-8,270,423 (-) (1913 bp)
Assembly Human, Ensembl v40 (NCBI 36)
Gene name ICA1
Ensembl gene ID ENSG00000003147
Gene description Islet cell autoantigen 1 (69 kDa islet cell autoantigen) (ICA69) (p69) (Islet cell autoantigen p69) (ICAp69). [Source:Uniprot/SWISSPROT;Acc:Q05084]
Gene description source HGNC Symbol
Modules
(Co-occurring motif patterns)
7 annotation-based module(s)
No 'de novo' modules exist in this database.

Genomic Context: Human genome assembly from Mar 2006. (UCSC hg18, NCBI 36, Ensembl v40)

The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.

UCSC Genome Browser Image    
  • The first track shows the location of the search region in red.
  • The last track shows known gene locations in this 100000 bp span of the genome.

This promoter-based search region is located close to a particular gene of interest, described in the table below. Click on the gene id to open a page at ensembl.org with more information about this gene.

Target gene used to create this search region
Ensembl ID ENSG00000003147 (ICA1)
Ensembl Transcript ID ENST00000317367
Gene description Islet cell autoantigen 1 (69 kDa islet cell autoantigen) (ICA69) (p69) (Islet cell autoantigen p69) (ICAp69). [Source:Uniprot/SWISSPROT;Acc:Q05084]
Gene type protein_coding
Gene location chr7: 8,163,029-8,268,710 (-) (105,682 bp)
Distance from the region's midpoint to TSS -757
The distance from a cisred search region to a gene, is measured from the center of the search region to either the transcription termination site (TTS) or the transcription start site (TSS), whichever is closer.
A distance is negative if the TTS/TTS is downstream of the search region's center, relative to the gene's strand.
A distance is positive if the TTS/TTS is upstream of the search region's center, relative to the gene's strand.

A transcript's location is always reported relative to the positive strand.

Image of Motifs and Modules

The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit. Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not any modules of that type exist, and if so, whether or not all the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)

User-specified filter settings do not affect the features displayed in the UCSC genome browser view.

About the patterns shown in this image:
There are no 'de novo' patterns to show.
All instances of each (TRANSFAC) annotation-based pattern are shown.
There are no (JASPAR) annotation-based patterns to show.

UCSC Genome Browser Image
Click on the image to view this region at UCSC.
    This image uses the Human genome assembly from Mar 2006. (UCSC hg18, NCBI 36, Ensembl v40) and contains a number of custom tracks followed by several UCSC tracks. The custom tracks show:
  • The long red and gray bar at the top shows the nominal 'search region' within which comparative genomics discovery methods were applied. Motif predictions were not made in coding exons and most types of repeats. In this database, the locations of masks applied to the search region are shown in gray.
  • The numbered brown blocks are 'atomic' motifs, i.e. conserved DNA sequence motifs that were identified by discovery methods and post-processing operations. Motifs are shaded to indicate the discovery p-value; a darker motif was more significant at the discovery stage.
  • Following the motif discovery stage, motifs were filtered by membership in co-occurring patterns, and patterns were ranked by genome-scale properties. Motifs instances that occur in highly-ranked putative regulatory modules may be more reliable predictions of functional genomic elements.
  • The connected sets of blue boxes are co-occurring patterns, i.e. putative regulatory modules. Modules are shaded to indicate the number of times that a pattern is found in the target genome; a darker module is associated with more search regions. An pattern is called either 'de novo' or annotation-based, depending on the type of groups that appear in the pattern. (see next point)
  • Before patterns (i.e. modules) can be identified from atomic motifs, groups of similar motifs must be found; modules are then identified as co-occurring 'group labels' that satisfy certain criteria. Such groups can be identified a) by annotating atomic motifs with known binding site resources from TRANSFAC, JASPAR or ORegAnno; or b) by 'de novo' clustering. Currently we show both types of patterns, but we consider annotation-based groups and patterns to be more reliable than 'de novo' groups and patterns. Work to improve genome-scale 'de novo' grouping is ongoing.

Motifs Found in this Region

The contents of the table below can be modified by changing your filter settings.
Currently, this table only contains motifs which:
+ have a discovery p-value < 0.1
+ were found using any of these algorithms: MotifSampler, Consensus.oops, Consensus.omops, Consensus.zmops, MEME.tcm, MEME.oops, MEME.zoops

Showing 13 out of 13 atomic motifs.

Group(s)
crtHsap#(name) [p-value]
Motif
craHsap#
Discovery
p-value
Location Width (+)motif (-)motif
0 annotated groups 322 6.99E-02 chr7:8,268,542-8,268,554 13  Seq Logo
mrGGGTGACCCCG
Seq Logo
CGGGGTCACCCyk
0 annotated groups 303 2.76E-02 chr7:8,268,670-8,268,681 12  Seq Logo
rCCCCAGGGTTC
Seq Logo
GAACCCTGGGGy
1 annotated group(s):
40087 (GLI1) [9.78E-04]
292 3.07E-03 chr7:8,268,699-8,268,705 7  Seq Logo
GGGCGGC
Seq Logo
GCCGCCC
0 annotated groups 286 3.16E-03 chr7:8,268,711-8,268,724 14  Seq Logo
GCAGGGGCGGGGTC
Seq Logo
GACCCCGCCCCTGC
10 annotated group(s):
50059 (Myc-Max) [6.90E-06]
50058 (Max) [1.97E-04]
40005 (ALF1A) [3.09E-04]
...
271 5.62E-03 chr7:8,268,732-8,268,750 19  Seq Logo
TGGACACGTGGAACACCTG
Seq Logo
CAGGTGTTCCACGTGTCCA
8 annotated group(s):
50066 (PPARgamma) [7.86E-05]
40001 (120-kDa_CRE-binding_protein) [1.82E-04]
40017 (ATF) [2.32E-04]
...
242 1.03E-04 chr7:8,268,756-8,268,767 12  Seq Logo
TTGTGACGCAAA
Seq Logo
TTTGCGTCACAA
5 annotated group(s):
50066 (PPARgamma) [7.86E-05]
50078 (SOX17) [5.66E-04]
40021 (ATF6) [7.38E-04]
...
256 5.62E-03 chr7:8,268,760-8,268,775 16  Seq Logo
CCAGGTCATTGTGACG
Seq Logo
CGTCACAATGACCTGG
7 annotated group(s):
50066 (PPARgamma) [7.86E-05]
50018 (CREB) [2.22E-04]
40201 (TEF) [2.40E-04]
...
231 1.03E-04 chr7:8,268,761-8,268,768 8  Seq Logo
ATTGTGAC
Seq Logo
GTCACAAT
1 annotated group(s):
40045 (COUP) [7.18E-04]
218 1.03E-04 chr7:8,268,823-8,268,828 6  Seq Logo
ACGCAm
Seq Logo
kTGCGT
7 annotated group(s):
40019 (ATF3) [9.53E-05]
40020 (ATF4) [2.58E-04]
40138 (Nkx2-1) [2.65E-04]
...
215 3.11E-02 chr7:8,268,879-8,268,898 20  Seq Logo
CACTGAAGTCATGAAGTCTC
Seq Logo
GAGACTTCATGACTTCAGTG
8 annotated group(s):
40178 (RSRFC4) [1.29E-04]
40201 (TEF) [1.36E-04]
40007 (aMEF-2) [1.65E-04]
...
207 3.82E-02 chr7:8,269,230-8,269,241 12  Seq Logo
TTATwTACATAw
Seq Logo
sTATGTAsATAA
6 annotated group(s):
40064 (E4BP4) [4.11E-05]
40093 (Hlf) [6.33E-05]
50043 (HLF) [7.34E-05]
...
204 9.55E-02 chr7:8,269,601-8,269,619 19  Seq Logo
mAAkGTyAwGwAAAkTTmy
Seq Logo
rkAAmTTTsCsTrACmTTk
6 annotated group(s):
40082 (FOXP1a) [6.59E-05]
40148 (OCA-B) [1.39E-04]
40164 (POU2F1) [1.55E-04]
...
193 5.93E-02 chr7:8,269,810-8,269,821 12  Seq Logo
wwATGTAwATAA
Seq Logo
TTATsTACATss

Questions or comments: cisred@bcgsc.ca