FILTERS:
pvalue:0.1
Motif craHsap154891
More information about this gene at Ensembl.org Go to UCSC
The contents of this page can be modified by changing your filter settings.
Currently, this page only shows information about a motif if it:
+ has a discovery p-value < 0.1
Filters based on species and motif discovery algorithms are not applied to the contents of this page.

This page describes one atomic motif in this cisRED database. An atomic motif is a result returned by cisRED's motif discovery process operating on an input sequence set. An input sequence set consists of a search region sequence on the target genome (shown in the genome browser view below) and corresponding sequences from other species. A motif consists of a set of conserved sequences ('hits'). It can be represented by a consensus sequence, a position frequency matrix and a sequence logo.

Page Contents

Overview
Sequence Conservation
Motif overview
Atomic motif id craHsap154891
Discovery p-value 8.03E-03
Motif location chr10: 17,211,848-17,211,867 (-) (20 bp)
Search region location chr10: 17,211,637-17,214,903 (-) (3,267 bp)
Assembly Human, Ensembl v40 (NCBI 36)
Found in 17 species: Pan troglodytes, Macaca mulatta, Procavia capensis, Loxodonta africana, Sus scrofa, Echinops telfairi, Pteropus vampyrus, Bos taurus, Otolemur garnettii, Canis familiaris, Equus caballus, Oryctolagus cuniculus, Erinaceus europaeus, Cavia porcellus, Rattus norvegicus, Homo sapiens, Monodelphis domestica
Found with
'De Novo' motif group ID This motif was not submitted for clustering.
Similar to
(annotation p-value)		 There are 9 annotation(s) with p-values below 0.001.
JASPAR: (1 annot.): COUP-TF(7.55E-04)
TRANSFAC: (8 annot.): HNF-4alpha1(7.67E-05) ,    HNF-4(1.24E-04) ,    TCF-4(2.38E-04) ,    VDR(2.80E-04) ,    HP1_site_factor(3.98E-04) ...
ORegAnno: (0 annot.): none
Modules
(Co-occurring motif patterns)		 Annotation-based:
No 'de novo' modules exist in this database.

Sequence Conservation
Sequence logo (+)motif (-)motif
Consensus sequence TCAkksswskTTTGACCTyT ArAGGTCAAAmwswwmmTGA
Position frequency matrix
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
A 4 5 17 2 1 7 8 0 10 2 0 0 0 0 17 1 0 0 1 0
C 1 10 0 0 0 0 0 6 1 2 0 0 0 0 0 16 17 2 7 0
G 2 2 0 8 9 0 2 8 0 5 0 0 0 17 0 0 0 0 2 0
T 10 0 0 7 7 10 7 3 6 8 17 17 17 0 0 0 0 15 7 17
w m A k k w w s w k T T T G A C C T y T
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
A 17 7 15 0 0 0 0 17 17 17 8 6 3 7 10 7 7 0 0 10
C 0 2 0 0 0 0 17 0 0 0 5 0 8 2 0 9 8 0 2 2
G 0 7 2 17 16 0 0 0 0 0 2 1 6 0 0 0 0 0 10 1
T 0 1 0 0 1 17 0 0 0 0 2 10 0 8 7 1 2 17 5 4
A r A G G T C A A A m w s w w m m T k w

In the table below, bases highlighted on the Target sequence will link to a single nucleotide polymoprhism in NCBI's dbSNP.

Site Sequence Stack
Ensembl gene ID Type Species Position Std (+)Sequence Std (-)Sequence
ENSG00000107611_PTRO Orthologue Pan troglodytes chr8:17,739,701-17,739,720 – TCAGGTAGATTTTGACCTCT + AGAGGTCAAAATCTACCTGA
ENSG00000107611_MMUL Orthologue Macaca mulatta chr9:17,417,904-17,417,923 – TAAGGTAGATTTTGACCTCT + AGAGGTCAAAATCTACCTTA
ENSG00000107611_PCAP Orthologue Procavia capensis ENSG00000107611_PCAP:107-126 – TCATTATCTGTTTGACCTTT + AAAGGTCAAACAGATAATGA
ENSG00000107611_LAFR Orthologue Loxodonta africana scaffold_5966:33,833-33,852 – TCATTATCTGTTTGACCTTT + AAAGGTCAAACAGATAATGA
ENSG00000107611_SSCR Orthologue Sus scrofa ENSG00000107611_SSCR:124-143 + AGAGGTAGATTTTGACCTGT – ACAGGTCAAAATCTACCTCT
ENSG00000107611_ETEL Orthologue Echinops telfairi scaffold_318030:51,573-51,592 – TCATTATCTGTTTGACCTTT + AAAGGTCAAACAGATAATGA
ENSG00000107611_PVAM Orthologue Pteropus vampyrus ENSG00000107611_PVAM:3,057-3,076 – GCAAATGTACTTTGACCTGT + ACAGGTCAAAGTACATTTGC
ENSG00000107611_BTAU Orthologue Bos taurus chr13:19,782,208-19,782,227 – AGAGGTAGATTTTGACCTCT + AGAGGTCAAAATCTACCTCT
ENSG00000107611_OGAR Orthologue Otolemur garnettii ENSG00000107611_OGAR:601-620 – TCATTATCTATTTGACCTTT + AAAGGTCAAATAGATAATGA
ENSG00000107611_CFAM Orthologue Canis familiaris chr2:22,618,860-22,618,879 + CAAGGTAGATTTTGACCTCT – AGAGGTCAAAATCTACCTTG
ENSG00000107611_ECAB Orthologue Equus caballus ENSG00000107611_ECAB:2,884-2,903 – ACATTATCTGTTTGACCTTT + AAAGGTCAAACAGATAATGT
ENSG00000107611_OCUN Orthologue Oryctolagus cuniculus scaffold_207677:98,652-98,671 – TAAGGTAGATTTTGACCTCT + AGAGGTCAAAATCTACCTTA
ENSG00000107611_EEUR Orthologue Erinaceus europaeus ENSG00000107611_EEUR:78-97 – TCATTATCCATTTGACCTTT + AAAGGTCAAATGGATAATGA
ENSG00000107611_CPOR Orthologue Cavia porcellus ENSG00000107611_CPOR:2,873-2,892 – TCATTATTTGTTTGACCTTT + AAAGGTCAAACAAATAATGA
ENSG00000107611_RNOR Orthologue Rattus norvegicus chr17:87,772,295-87,772,314 – TAAGGTAGATTTTGACCCCT + AGGGGTCAAAATCTACCTTA
ENSG00000107611 Target Homo sapiens chr10:17,211,848-17,211,867 + GCAGGTGTACTTTGAACCAT – ATGGTTCAAAGTACACCTGC
ENSG00000107611_MDOM Orthologue Monodelphis domestica chr8:252,785,074-252,785,093 + AAAAGTAGATTTTGACCTCT – AGAGGTCAAAATCTACTTTT

Questions or comments: cisred@bcgsc.ca