The contents of this page can be modified by changing your
filter settings.
Currently, this page only shows information about a motif if it:
+ has a discovery p-value < 0.1
Filters based on species and motif discovery algorithms are not applied to the contents of this page.
Currently, this page only shows information about a motif if it:
+ has a discovery p-value < 0.1
Filters based on species and motif discovery algorithms are not applied to the contents of this page.
This page describes one atomic motif in this cisRED database. An atomic motif is a result returned by cisRED's motif discovery process operating on an input sequence set. An input sequence set consists of a search region sequence on the target genome (shown in the genome browser view below) and corresponding sequences from other species. A motif consists of a set of conserved sequences ('hits'). It can be represented by a consensus sequence, a position frequency matrix and a sequence logo.
Page ContentsOverviewSequence Conservation |
| Motif overview | |
| craHsap154891 | |
| Discovery p-value | 8.03E-03 |
| chr10: 17,211,848-17,211,867 (-) (20 bp) | |
| chr10: 17,211,637-17,214,903 (-) (3,267 bp) | |
| Human, Ensembl v40 (NCBI 36) | |
| 17 species: Pan troglodytes, Macaca mulatta, Procavia capensis, Loxodonta africana, Sus scrofa, Echinops telfairi, Pteropus vampyrus, Bos taurus, Otolemur garnettii, Canis familiaris, Equus caballus, Oryctolagus cuniculus, Erinaceus europaeus, Cavia porcellus, Rattus norvegicus, Homo sapiens, Monodelphis domestica | |
| This motif was not submitted for clustering. | |
(annotation p-value) |
There are
9 annotation(s)
with p-values below 0.001. JASPAR: (1 annot.): COUP-TF(7.55E-04) TRANSFAC: (8 annot.): HNF-4alpha1(7.67E-05) , HNF-4(1.24E-04) , TCF-4(2.38E-04) , VDR(2.80E-04) , HP1_site_factor(3.98E-04) ... ORegAnno: (0 annot.): none |
| Modules |
Annotation-based:
No 'de novo' modules exist in this database. |
Sequence Conservation
In the table below, bases highlighted on the Target sequence will link to a single nucleotide polymoprhism in NCBI's dbSNP.
| Site Sequence Stack | |||||||
| Ensembl gene ID | Type | Species | Position | Std | (+)Sequence | Std | (-)Sequence |
|---|---|---|---|---|---|---|---|
| ENSG00000107611_PTRO | Orthologue | Pan troglodytes | chr8:17,739,701-17,739,720 | – | TCAGGTAGATTTTGACCTCT | + | AGAGGTCAAAATCTACCTGA |
| ENSG00000107611_MMUL | Orthologue | Macaca mulatta | chr9:17,417,904-17,417,923 | – | TAAGGTAGATTTTGACCTCT | + | AGAGGTCAAAATCTACCTTA |
| ENSG00000107611_PCAP | Orthologue | Procavia capensis | ENSG00000107611_PCAP:107-126 | – | TCATTATCTGTTTGACCTTT | + | AAAGGTCAAACAGATAATGA |
| ENSG00000107611_LAFR | Orthologue | Loxodonta africana | scaffold_5966:33,833-33,852 | – | TCATTATCTGTTTGACCTTT | + | AAAGGTCAAACAGATAATGA |
| ENSG00000107611_SSCR | Orthologue | Sus scrofa | ENSG00000107611_SSCR:124-143 | + | AGAGGTAGATTTTGACCTGT | – | ACAGGTCAAAATCTACCTCT |
| ENSG00000107611_ETEL | Orthologue | Echinops telfairi | scaffold_318030:51,573-51,592 | – | TCATTATCTGTTTGACCTTT | + | AAAGGTCAAACAGATAATGA |
| ENSG00000107611_PVAM | Orthologue | Pteropus vampyrus | ENSG00000107611_PVAM:3,057-3,076 | – | GCAAATGTACTTTGACCTGT | + | ACAGGTCAAAGTACATTTGC |
| ENSG00000107611_BTAU | Orthologue | Bos taurus | chr13:19,782,208-19,782,227 | – | AGAGGTAGATTTTGACCTCT | + | AGAGGTCAAAATCTACCTCT |
| ENSG00000107611_OGAR | Orthologue | Otolemur garnettii | ENSG00000107611_OGAR:601-620 | – | TCATTATCTATTTGACCTTT | + | AAAGGTCAAATAGATAATGA |
| ENSG00000107611_CFAM | Orthologue | Canis familiaris | chr2:22,618,860-22,618,879 | + | CAAGGTAGATTTTGACCTCT | – | AGAGGTCAAAATCTACCTTG |
| ENSG00000107611_ECAB | Orthologue | Equus caballus | ENSG00000107611_ECAB:2,884-2,903 | – | ACATTATCTGTTTGACCTTT | + | AAAGGTCAAACAGATAATGT |
| ENSG00000107611_OCUN | Orthologue | Oryctolagus cuniculus | scaffold_207677:98,652-98,671 | – | TAAGGTAGATTTTGACCTCT | + | AGAGGTCAAAATCTACCTTA |
| ENSG00000107611_EEUR | Orthologue | Erinaceus europaeus | ENSG00000107611_EEUR:78-97 | – | TCATTATCCATTTGACCTTT | + | AAAGGTCAAATGGATAATGA |
| ENSG00000107611_CPOR | Orthologue | Cavia porcellus | ENSG00000107611_CPOR:2,873-2,892 | – | TCATTATTTGTTTGACCTTT | + | AAAGGTCAAACAAATAATGA |
| ENSG00000107611_RNOR | Orthologue | Rattus norvegicus | chr17:87,772,295-87,772,314 | – | TAAGGTAGATTTTGACCCCT | + | AGGGGTCAAAATCTACCTTA |
| ENSG00000107611 | Target | Homo sapiens | chr10:17,211,848-17,211,867 | + | GCAGGTGTACTTTGAACCAT | – | ATGGTTCAAAGTACACCTGC |
| ENSG00000107611_MDOM | Orthologue | Monodelphis domestica | chr8:252,785,074-252,785,093 | + | AAAAGTAGATTTTGACCTCT | – | AGAGGTCAAAATCTACTTTT |

