Region for Gene ENSRNOG00000000632 (Uniprot/SWISSPROT: Cdc2)

This page describes one promoter-based search region.

The image shown below was created to provide context for this search region by showing a 100000 bp span of the genome, centered on this search region.

The first track shows the location of the search region in red. The last track shows known gene locations in this 100000 bp span of the genome.

This promoter-based search region is located close to a particular gene of interest, described in the table below. Click on the gene id to open a page at ensembl.org with more information about this gene.

The image shown below illustrates the location of the motifs and modules within this search region.
However, the number of modules in a region may exceed the genome browser's track limit. Thus, for each type of module (pattern), the text in the yellow box below indicates whether or not any modules of that type exist, and if so, whether or not all the modules of that type are displayed. (If it indicates that only the top 20 modules are displayed, this ranking is based on the number of instances of each module.)

User-specified filter settings do not affect the features displayed in the UCSC genome browser view.

About the patterns shown in this image:
There are no 'de novo' patterns to show.
There are no (TRANSFAC) annotation-based patterns to show.
There are no (JASPAR) annotation-based patterns to show.

Click on the image to view this region at UCSC.

This image uses the Rat genome assembly from Jun 2003. (UCSC rn3, RGSC 3.1, Ensembl v22) and contains a number of custom tracks followed by several UCSC tracks. The custom tracks show: The long red and gray bar at the top shows the nominal 'search region' within which comparative genomics discovery methods were applied. Motif predictions were not made in coding exons and most types of repeats. In this database, the locations of masks applied to the search region are shown in gray. The numbered brown blocks are 'atomic' motifs, i.e. conserved DNA sequence motifs that were identified by discovery methods and post-processing operations. Motifs are shaded to indicate the discovery p-value; a darker motif was more significant at the discovery stage. Following the motif discovery stage, motifs were filtered by membership in co-occurring patterns, and patterns were ranked by genome-scale properties. Motifs instances that occur in highly-ranked putative regulatory modules may be more reliable predictions of functional genomic elements. The connected sets of blue boxes are co-occurring patterns, i.e. putative regulatory modules. Modules are shaded to indicate the number of times that a pattern is found in the target genome; a darker module is associated with more search regions. An pattern is called either 'de novo' or annotation-based, depending on the type of groups that appear in the pattern. (see next point) Before patterns (i.e. modules) can be identified from atomic motifs, groups of similar motifs must be found; modules are then identified as co-occurring 'group labels' that satisfy certain criteria. Such groups can be identified a) by annotating atomic motifs with known binding site resources from TRANSFAC, JASPAR or ORegAnno; or b) by 'de novo' clustering. Currently we show both types of patterns, but we consider annotation-based groups and patterns to be more reliable than 'de novo' groups and patterns. Work to improve genome-scale 'de novo' grouping is ongoing.

Showing 18 out of 18 atomic motifs.

Group(s) crtRnor#(name) [p-value]	Motif craRnor#	Discovery p-value	Location	Width	(+)motif	(-)motif
0 annotated groups 0 'de novo' group(s)	28276	5.49E-02	chr20:20,028,949-20,028,960	12	GGCGCCCGCCCT	AGGGCGGGCGCC
0 annotated groups 1 'de novo' group(s) 7911	28326	7.31E-02	chr20:20,029,097-20,029,109	13	TCAATTTAACTCA	TGAGTTAAATTGA
0 annotated groups 0 'de novo' group(s)	28368	1.16E-01	chr20:20,030,332-20,030,348	17	TnCmTTTAACATwmAnn	nnTksATGTTAAAkGnA
0 annotated groups 1 'de novo' group(s) 7337	28407	2.50E-02	chr20:20,030,388-20,030,400	13	ATACATwATrwAn	nTsyATsATGTAT
0 annotated groups 1 'de novo' group(s) 3276	28459	2.06E-01	chr20:20,030,439-20,030,445	7	GGCGGGC	GCCCGCC
0 annotated groups 1 'de novo' group(s) 13487	28497	1.16E-01	chr20:20,030,657-20,030,675	19	CAATCnGrTAGCmCGTAGA	TCTACGkGCTAyCnGATTG
0 annotated groups 1 'de novo' group(s) 13992	28533	1.30E-01	chr20:20,030,681-20,030,700	20	yATGyywsTsTsTATATAwk	msTATATAwAwAwsrrCATr
0 annotated groups 0 'de novo' group(s)	28563	1.15E-01	chr20:20,031,193-20,031,214	22	CTnnwmATAATAAAnnT...	AATnnAnnTTTATTATk...
0 annotated groups 0 'de novo' group(s)	28588	1.16E-01	chr20:20,031,273-20,031,292	20	wnArkAATnTTTAAnATTnn	nnAATnTTAAAnATTmyTns
0 annotated groups 1 'de novo' group(s) 8578	28620	2.41E-01	chr20:20,031,502-20,031,514	13	CTAATCACTTTTA	TAAAAGTGATTAG
0 annotated groups 1 'de novo' group(s) 1094	28653	2.50E-02	chr20:20,031,539-20,031,547	9	ATTTwAAAT	ATTTsAAAT
0 annotated groups 1 'de novo' group(s) 13226	28698	2.07E-03	chr20:20,031,660-20,031,679	20	TCAGTTGGCGCCCGCCCTCC	GGAGGGCGGGCGCCAACTGA
0 annotated groups 1 'de novo' group(s) 14663	28733	2.19E-01	chr20:20,031,705-20,031,725	21	GskCCCTTTmGCGCksT...	rCkCAwmGCGCkAAAGG...
0 annotated groups 1 'de novo' group(s) 12183	28777	2.47E-01	chr20:20,031,782-20,031,793	12	TACrTrsAAkyk	mrmTTwyAyGTA
0 annotated groups 1 'de novo' group(s) 3372	28816	2.41E-02	chr20:20,031,804-20,031,810	7	CCCGGGA	TCCCGGG
0 annotated groups 0 'de novo' group(s)	28851	2.50E-02	chr20:20,031,810-20,031,839	30	GCCCTTTAGCGCGGTGA...	AGCAGTTTCAAACTCAC...
0 annotated groups 1 'de novo' group(s) 6393	28896	2.33E-02	chr20:20,031,956-20,031,967	12	GGGCGGGCkCCA	TGGmGCCCGCCC
0 annotated groups 1 'de novo' group(s) 2463	28950	7.50E-03	chr20:20,031,985-20,031,992	8	myCCGGGG	CCCCGGrk